Difference between revisions of "Part:BBa K1352006:Experience"
Line 24: | Line 24: | ||
[[File:K1352006 amongst recombinants HindIII.PNG|600px|thumb|left|Figure 1]] | [[File:K1352006 amongst recombinants HindIII.PNG|600px|thumb|left|Figure 1]] | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
Figure 1; a Xba1 + HindIII restriction digest screen of recombinants. The recombinant which went on to become K1352006 is in lane 5. The “L” lane is DNA marker (ladder). The arrows are to highlight the distance travelled by the HindIII-negative recombinants. | Figure 1; a Xba1 + HindIII restriction digest screen of recombinants. The recombinant which went on to become K1352006 is in lane 5. The “L” lane is DNA marker (ladder). The arrows are to highlight the distance travelled by the HindIII-negative recombinants. | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | [[K1352006 standard digest.PNG|600px|thumb|left|Figure 2]] | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
Revision as of 15:01, 4 October 2014
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K1352006
User Reviews
UNIQe982298e29f95e49-partinfo-00000000-QINU UNIQe982298e29f95e49-partinfo-00000001-QINU
Restriction digest + Gel electrophoresis
Figure 1; a Xba1 + HindIII restriction digest screen of recombinants. The recombinant which went on to become K1352006 is in lane 5. The “L” lane is DNA marker (ladder). The arrows are to highlight the distance travelled by the HindIII-negative recombinants.
Figure 2; a restriction digest verification of plasmid K1352006
For figure 2: the letters indicate the following:
L. 10,000bp – 500bp DNA marker “ladder”
N. K1352006 plasmid digested with no enzymes
E. K1352006 plasmid digested with EcoRI
X. K1352006 plasmid digested with XbaI
S. K1352006 plasmid digested with SpeI
P. K1352006 plasmid digested with PstI
EP. K1352006 plasmid digested with EcoRI and PstI
XS. K1352006 plasmid digested with XbaI and Spe1
DNA Sequencing The recombinant plasmid was Sanger-sequenced with the following sequencing primers. “G101” is a reverse primer, the rest are forward primers.
“G101” (attaccgcctttgagtgagc)
“G100” (tgccacctgacgtctaagaa)
“35 INP-SEQ 1” (ccgattcattaatgcagctgg)
“36 INP-SEQ 2” (gaggttgctgttgccgac)
“37 INP-SEQ 3” (ggtgtggaagccgacattc)
The plasmid insert was found to be exactly as desired. Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).
Conclusions
The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the N-terminus of the linker sequence after INP. However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies.