Difference between revisions of "Part:BBa K1352004:Experience"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
 
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
Line 19: Line 18:
 
<!-- End of the user review template -->
 
<!-- End of the user review template -->
 
<!-- DON'T DELETE --><partinfo>BBa_K1352004 EndReviews</partinfo>
 
<!-- DON'T DELETE --><partinfo>BBa_K1352004 EndReviews</partinfo>
 +
 +
 +
 +
Florescence Microscopy
 +
The following composite images were produced by superimposing a bright-field image with an YFP-filtered image.
 +
 +
Figure 1, Panel A; a composite fluorescence image – brightfield micrograph of a pSB1A3-transformed liquid cell culture (negative control) exhibiting no fluorescence as expected.
 +
 +
 +
Figure 1, Panel B; a composite fluorescence image – brightfield micrograph of a K523013-transformed liquid cell culture exhibiting yellow fluorescence as expected.
 +
 +
 +
Figure 1, Panel C; a composite fluorescence image – brightfield micrograph of a K1352004-transformed liquid cell culture exhibiting yellow fluorescence.
 +
 +
 +
Confirmation of K1352004 DNA construct and the insertion of a MCS
 +
 +
 +
Figure 2; a restriction digest verification of plasmids K1352004, K523013, and “INP-YFP-His” (a previously created plasmid which identical to K1352004 except that the FLAG tag is a 6xHis tag)
 +
 +
For figure 2: L stands for 10,000bp – 500bp DNA marker “ladder”, and the numbers indicate the following:
 +
1. INP-YFP-His plasmid undigested
 +
2. INP-YFP-His plasmid digested with XbaI
 +
3. INP-YFP-His plasmid digested with XbaI and HindIII
 +
4. INP-YFP-His plasmid digested with XbaI and BglII
 +
5. K523013 plasmid undigested
 +
6. K523013 plasmid digested with XbaI
 +
7. K523013 plasmid digested with XbaI and HindIII
 +
8. K523013 plasmid digested with XbaI and BglII
 +
9. K1352004 plasmid undigested
 +
10. K1352004 plasmid digested with XbaI
 +
11. K1352004 plasmid digested with XbaI and HindIII
 +
12. K1352004 plasmid digested with XbaI and BglII
 +
 +
 +
Figure 3; a restriction digest verification of plasmid K1352004
 +
 +
For figure 3: the letters indicate the following:
 +
L. 10,000bp – 500bp DNA marker “ladder”
 +
N. K1352004 plasmid digested with no enzymes
 +
E. K1352004 plasmid digested with EcoRI
 +
X. K1352004 plasmid digested with XbaI
 +
S. K1352004 plasmid digested with SpeI
 +
P. K1352004 plasmid digested with PstI
 +
EP. K1352004 plasmid digested with EcoRI and PstI
 +
XS. K1352004 plasmid digested with XbaI and Spe1
 +
 +
Western Blot to confirm the presence and size of the translated INP-YFP-FLAG protein
 +
 +
 +
Figure 4,
 +
 +
For figure 4 nitrocellulose paper, from left-to-right the lanes are:
 +
1. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #1
 +
2. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #2
 +
3. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #1
 +
4. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #2
 +
5. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #3
 +
6. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #4
 +
7. Protein marker “ladder”
 +
 +
DNA Sequencing
 +
The recombinant plasmid was Sanger-sequenced with the following sequencing primers.  “G101” is a reverse primer, the rest are forward primers.
 +
“G101” (attaccgcctttgagtgagc)
 +
“G100” (tgccacctgacgtctaagaa)
 +
“35 INP-SEQ 1” (ccgattcattaatgcagctgg)
 +
“36 INP-SEQ 2” (gaggttgctgttgccgac)
 +
“37 INP-SEQ 3” (ggtgtggaagccgacattc)
 +
The plasmid insert was found to be exactly as desired.  Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).
 +
 +
Conclusions
 +
The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the N-terminus of YFP.  However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies.

Revision as of 12:25, 4 October 2014

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1352004

User Reviews

UNIQ0fce3e4d6dd259f9-partinfo-00000000-QINU UNIQ0fce3e4d6dd259f9-partinfo-00000001-QINU


Florescence Microscopy The following composite images were produced by superimposing a bright-field image with an YFP-filtered image.

Figure 1, Panel A; a composite fluorescence image – brightfield micrograph of a pSB1A3-transformed liquid cell culture (negative control) exhibiting no fluorescence as expected.


Figure 1, Panel B; a composite fluorescence image – brightfield micrograph of a K523013-transformed liquid cell culture exhibiting yellow fluorescence as expected.


Figure 1, Panel C; a composite fluorescence image – brightfield micrograph of a K1352004-transformed liquid cell culture exhibiting yellow fluorescence.


Confirmation of K1352004 DNA construct and the insertion of a MCS


Figure 2; a restriction digest verification of plasmids K1352004, K523013, and “INP-YFP-His” (a previously created plasmid which identical to K1352004 except that the FLAG tag is a 6xHis tag)

For figure 2: L stands for 10,000bp – 500bp DNA marker “ladder”, and the numbers indicate the following: 1. INP-YFP-His plasmid undigested 2. INP-YFP-His plasmid digested with XbaI 3. INP-YFP-His plasmid digested with XbaI and HindIII 4. INP-YFP-His plasmid digested with XbaI and BglII 5. K523013 plasmid undigested 6. K523013 plasmid digested with XbaI 7. K523013 plasmid digested with XbaI and HindIII 8. K523013 plasmid digested with XbaI and BglII 9. K1352004 plasmid undigested 10. K1352004 plasmid digested with XbaI 11. K1352004 plasmid digested with XbaI and HindIII 12. K1352004 plasmid digested with XbaI and BglII


Figure 3; a restriction digest verification of plasmid K1352004

For figure 3: the letters indicate the following: L. 10,000bp – 500bp DNA marker “ladder” N. K1352004 plasmid digested with no enzymes E. K1352004 plasmid digested with EcoRI X. K1352004 plasmid digested with XbaI S. K1352004 plasmid digested with SpeI P. K1352004 plasmid digested with PstI EP. K1352004 plasmid digested with EcoRI and PstI XS. K1352004 plasmid digested with XbaI and Spe1

Western Blot to confirm the presence and size of the translated INP-YFP-FLAG protein


Figure 4,

For figure 4 nitrocellulose paper, from left-to-right the lanes are: 1. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #1 2. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #2 3. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #1 4. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #2 5. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #3 6. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #4 7. Protein marker “ladder”

DNA Sequencing The recombinant plasmid was Sanger-sequenced with the following sequencing primers. “G101” is a reverse primer, the rest are forward primers. “G101” (attaccgcctttgagtgagc) “G100” (tgccacctgacgtctaagaa) “35 INP-SEQ 1” (ccgattcattaatgcagctgg) “36 INP-SEQ 2” (gaggttgctgttgccgac) “37 INP-SEQ 3” (ggtgtggaagccgacattc) The plasmid insert was found to be exactly as desired. Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).

Conclusions The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the N-terminus of YFP. However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies.