Difference between revisions of "Help:BioBrick Prefix and Suffix"

m (use span instead of div for inline styles)
(→‎BioBrick Prefix)
Line 15: Line 15:
  
 
==BioBrick Prefix==
 
==BioBrick Prefix==
−
The standard BioBrick prefix depends on the part that follows it.
+
The standard BioBrick prefix depends on the part that follows it (<FONT COLOR="#BABABA">part in grey</FONT>, <FONT COLOR="#CC00FF">EcoRI</FONT>,<FONT COLOR="#FF5333"> XbaI</FONT>).
−
{|width='80%' style='border:1px solid gray; margin-left:2em'
+
{|width='85%' style='border:1px solid gray; margin-left:2em'
−
|width='50%'|
+
|width='45%'|
 
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:
 
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:
−
|width='50%' valign='top'|
+
|width='55%' valign='top'|
−
<span style='font-family:monospace;font-size:175%;padding-left:1em;'>gaattcgcggccgcttctag</span>
+
'''<span style='font-family:monospace;font-size:175%;padding-left:1em;'><FONT COLOR="#CC00FF">gaattc</FONT>gcggccgct<FONT COLOR="#FF5333">tctag</FONT><FONT COLOR="#BABABA">ATG...</FONT></span>'''
 
|-
 
|-
−
|width='50%'|
+
|width='45%'|
 
Otherwise, the BioBrick prefix is:
 
Otherwise, the BioBrick prefix is:
−
|width='50%'|
+
|width='55%'|
−
<span style='font-family:monospace;font-size:175%;padding-left:1em'>gaattcgcggccgcttctagag</span>
+
'''<span style='font-family:monospace;font-size:175%;padding-left:1em'><FONT COLOR="#CC00FF">gaattc</FONT>gcggccgct<FONT COLOR="#FF5333">tctaga</FONT>g<FONT COLOR="#BABABA">CA...</FONT></span>'''
 
|}
 
|}
−
 
  
 
==BioBrick Suffix==
 
==BioBrick Suffix==

Revision as of 16:22, 22 August 2006

Partinps.png

For more information about how the prefix and suffix were determined and the special case of coding regions, see Assembly:RBS-CDS_issues.

Part Sequence

The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include any bases of the BioBrick Prefix or Suffix.

Plasmids (see below) and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.


BioBrick Prefix

The standard BioBrick prefix depends on the part that follows it (part in grey, EcoRI, XbaI).

If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:

gaattcgcggccgcttctagATG...

Otherwise, the BioBrick prefix is:

gaattcgcggccgcttctagagCA...

BioBrick Suffix

The standard BioBrick suffix is always:

tactagtagcggccgctgcag


BioBrick Scar

When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts.

If the second part starts "AT", the scar is:

tactag

Otherwise, the scar is:

tactagag


Plasmid Sequences

Since plasmids are circular pieces of DNA, the specification of the "first" base is arbitrary. Furthermore, plasmids often hold BioBrick parts, leading to a question of how the plasmid itself is defined.

In the Registry, we define the plasmid as starting with the first base of the suffix and ending with the last base of the BioBrick prefix. That definition keeps the plasmid continuous and breaks it where parts will be inserted.