Difference between revisions of "Part:BBa K1114000"
(Blanked the page) |
|||
Line 1: | Line 1: | ||
+ | <html><head> | ||
+ | <style> | ||
+ | div{ | ||
+ | word-wrap:break-word; | ||
+ | } | ||
+ | </style> | ||
+ | <title class="name">BBa_E1010</title> | ||
+ | <link rel="shortcut icon" href="images/logo-Owl-Color_cropped.ico"> | ||
+ | <link href="//netdna.bootstrapcdn.com/bootstrap/3.1.1/css/bootstrap.min.css" rel="stylesheet"> | ||
+ | <link rel="stylesheet" type="text/css" media="print" href="//netdna.bootstrapcdn.com/bootstrap/3.1.1/css/bootstrap.min.css"> | ||
+ | <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> | ||
+ | <style type="text/css"></style></head> | ||
+ | <body class="container" id="main" style="padding-top: 10px;"> | ||
+ | <h1><img style="width: 48px; height: 40px; margin-top:2px" src="images/logo-Owl-Color_cropped.png"><small> Automatically build Datasheets</small></h1> | ||
+ | <!--summary--> | ||
+ | <div class="well" id="basicInformation"> | ||
+ | <h1 class="name">BBa_E1010</h1> | ||
+ | <h3>Part Description</h3> | ||
+ | <div class="container"> | ||
+ | <div class="row"> | ||
+ | <div class="col-xs-6"> | ||
+ | |||
+ | |||
+ | <h4>Summary</h4> | ||
+ | <p id="summary">**highly** engineered mutant of red fluorescent protein from Discosoma striata (coral)</p> | ||
+ | </div> | ||
+ | <div class="col-xs-6"> | ||
+ | |||
+ | <h4>Sequence</h4> | ||
+ | <p id="sequence" style="width:80%;word-wrap: break-word;">atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagtt cgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgc tgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccg gactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgt tacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc cggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaa atcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggt tcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagt acgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc</p> | ||
+ | </div> | ||
+ | </div> | ||
+ | <div class="row"> | ||
+ | |||
+ | <div class="col-xs-6"> | ||
+ | |||
+ | <h4>Pigeon Image</h4> | ||
+ | <div class="row-fluid span6" id="deviceImage"><img src="" class="img-polaroid" style="width:80%;"></div> | ||
+ | </div> | ||
+ | |||
+ | <div class="col-xs-6"> | ||
+ | <h4>Plasmid Map</h4> | ||
+ | |||
+ | <div class="row-fluid span6" id="plasmidMap"><img src="" class="img-polaroid" style="width:80%;"></div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | <div class="row"> | ||
+ | <div class="col-xs-6"> | ||
+ | <h4> Part Type </h4> | ||
+ | |||
+ | <div id="partType"> | ||
+ | Basic Part | ||
+ | </div> | ||
+ | |||
+ | |||
+ | </div> | ||
+ | <div class="col-xs-6"> | ||
+ | <h4> Related Parts </h4> | ||
+ | |||
+ | <div id="relatedParts" style="width:80%"></div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | |||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <div class="well" id="designerInfo"> | ||
+ | <h3>Designer Information</h3> | ||
+ | <div class="container"> | ||
+ | <div class="row"> | ||
+ | <div class="col-xs-4"><h4>Author(s)</h4><div id="authors">Drew Endy</div></div> | ||
+ | <div class="col-xs-4"><h4>Data Collectors</h4><div id="dataCollection"></div></div> | ||
+ | <div class="col-xs-4"><h4>Date</h4><div id="date" style="width:80%">2004-07-28</div></div> | ||
+ | </div> | ||
+ | <div class="row"> | ||
+ | <div class="col-xs-4"><h4>Affiliation</h4><div id="affiliation"></div></div> | ||
+ | <div class="col-xs-4"><h4>Team</h4><div id="team"></div></div> | ||
+ | <div class="col-xs-4"><h4>Contact</h4><div id="contact" style="width:80%"></div></div> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | |||
+ | <div class="well" id="designDetails"> | ||
+ | |||
+ | <h3>Designer Details</h3> | ||
+ | <div class="container"> | ||
+ | <div class="row"> | ||
+ | <div class="col-xs-3"><h4>Type</h4><div id="type"></div></div> | ||
+ | <div class="col-xs-3"><h4>Vector</h4><div id="vector"></div></div> | ||
+ | <div class="col-xs-3"><h4>Design Components</h4><div id="designComponents"></div></div> | ||
+ | <div class="col-xs-3"><h4>Additional Comments</h4><div id="designComments" style="width:80%"></div></div> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | |||
+ | <div class="well" id="assemblyInformation"> | ||
+ | <h3>Assembly Information</h3> | ||
+ | <div class="container"> | ||
+ | <div class="row"> | ||
+ | <div class="col-xs-3"><h4>Assembly Method(s)</h4><div id="assemblyMethod"></div></div> | ||
+ | <div class="col-xs-3"><h4>Chassis</h4><div id="chassis"></div></div> | ||
+ | <div class="col-xs-3"><h4>Assembly RFC</h4><div id="assemblyRFC"></div></div> | ||
+ | <div class="col-xs-3"><h4>Strain</h4><div id="strain" style="width:80%"></div></div> | ||
+ | </div> | ||
+ | <div class="row"> | ||
+ | |||
+ | <div class="col-xs-3"><h4>Scars (y/n)</h4><div id="assemblyScars"></div></div> | ||
+ | <div class="col-xs-3"><h4>Additional Comments</h4><div id="assemblyComments"></div></div> | ||
+ | <div class="col-xs-3"><h4>Assembly Components</h4><div id="assemblyComponents" style="width:80%"></div></div> | ||
+ | |||
+ | </div> | ||
+ | <div class="row"> | ||
+ | |||
+ | <div class="col-xs-6"><h4>Assembly Graph</h4><div id="assemblyImage"><img src="" class="img-polaroid" style="width:80%;"></div></div> | ||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | </div> | ||
+ | |||
+ | <script src="//ajax.googleapis.com/ajax/libs/jquery/2.0.3/jquery.min.js"></script> | ||
+ | <script src="//netdna.bootstrapcdn.com/bootstrap/3.0.0/js/bootstrap.min.js"></script> | ||
+ | <script> | ||
+ | $.get("DataServlet", function(data) { | ||
+ | |||
+ | |||
+ | console.log(data); | ||
+ | // a function to check is an entire field is empty | ||
+ | var hasOwnProperty = Object.prototype.hasOwnProperty; | ||
+ | |||
+ | function isEmpty(obj) { | ||
+ | |||
+ | // null and undefined are "empty" | ||
+ | if (obj == null) return true; | ||
+ | |||
+ | // Assume if it has a length property with a non-zero value | ||
+ | // that that property is correct. | ||
+ | //if (obj.length > 0) return false; | ||
+ | if (obj.length === 0) return true; | ||
+ | |||
+ | // Otherwise, does it have any properties of its own? | ||
+ | // Note that this doesn't handle | ||
+ | // toString and valueOf enumeration bugs in IE < 9 | ||
+ | for (var key in obj) { | ||
+ | if (hasOwnProperty.call(obj, key)) return false; | ||
+ | } | ||
+ | |||
+ | return true; | ||
+ | } | ||
+ | |||
+ | //console.log(data); | ||
+ | $(".name").text(data.name); | ||
+ | $("#summary").text(data.summary); | ||
+ | $("#sequence").text(data.sequence); | ||
+ | $("#partType").text(data.partType); | ||
+ | $("#relatedParts").text(data.relatedParts); | ||
+ | $("#deviceImage img").attr('src', data.deviceImage); | ||
+ | $("#plasmidMap img").attr('src', data.plasmidMap); | ||
+ | |||
+ | |||
+ | //Contact Info | ||
+ | $("#authors").text(data.contactInformation.authors); | ||
+ | $("#team").text(data.contactInformation.team); | ||
+ | $("#dataCollection").text(data.contactInformation.dataCollection); | ||
+ | $("#affiliation").text(data.contactInformation.affiliation); | ||
+ | $("#date").text(data.contactInformation.date); | ||
+ | $("#contact").text(data.contactInformation.contact); | ||
+ | |||
+ | //Design Detail | ||
+ | //console.log(data.designDetails); | ||
+ | $("#type").text(data.designDetails.type); | ||
+ | $("#vector").text(data.designDetails.vector); | ||
+ | $("#designComponents").text(data.designDetails.designComponents); | ||
+ | $("#designComments").text(data.designDetails.designComments); | ||
+ | |||
+ | //Assembly | ||
+ | $("#assemblyMethod").text(data.assemblyInformation.assemblyMethod); | ||
+ | $("#chassis").text(data.assemblyInformation.chassis); | ||
+ | $("#assemblyRFC").text(data.assemblyInformation.assemblyRFC); | ||
+ | $("#assemblyScars").text(data.assemblyInformation.assemblyScars); | ||
+ | $("#assemblyComponents").text(data.assemblyInformation.assemblyComponents); | ||
+ | $("#chasis").text(data.assemblyInformation.chasis); | ||
+ | $("#strain").text(data.assemblyInformation.strain); | ||
+ | $("#assemblyComments").text(data.assemblyInformation.assemblyComments); | ||
+ | $("#assemblyImage img").attr('src', data.assemblyImage); | ||
+ | |||
+ | //Assay Table | ||
+ | |||
+ | // var rmap = data.restrictionMap; | ||
+ | |||
+ | if (!isEmpty(data.restrictionMap)) { | ||
+ | $('#main').append('<div class="well"><h3>Restriction Map</h3><div class = "container"><div class = "row"><div class = "col-xs-3"><h4>Gel Buffer</h4><div>'+ data.restrictionMap.GelBuffer +'</div></div><div class = "col-xs-3"><h4>DNA Quality</h4><div>'+data.restrictionMap.DNAQuantity +'</div></div><div class = "col-xs-3"><h4>Percent Agar</h4><div>'+data.restrictionMap.Agar +'</div></div><div class = "col-xs-3"><h4>Enzymes</h4><div style = "width:80%">'+data.restrictionMap.Enzymes | ||
+ | +'</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Ladder</h4><div>'+ data.restrictionMap.Ladder +'</div></div><div class = "col-xs-3"><h4>Digest Buffer</h4><div>'+data.restrictionMap.DigestBuffer +'</div></div><div class = "col-xs-3"><h4>Staining Dye</h4><div>'+data.restrictionMap.StainingDye +'</div></div><div class = "col-xs-3"><h4>Digest Time</h4><div style = "width:80%">'+data.restrictionMap.DigestTime | ||
+ | + '</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Voltage</h4><div>'+ data.restrictionMap.Voltage +'</div></div><div class = "col-xs-3"><h4>Gel Image</h4><div><img src="'+data.restrictionMap.Image+'" class="img-polaroid" style = "width:80%;"/>'+ '</div></div><div class = "col-xs-3"><h4>Time</h4><div>'+data.restrictionMap.Time +'</div></div><div class = "col-xs-3"><h4>Caption for Image</h4><div style = "width:80%">'+data.restrictionMap.Caption | ||
+ | + '</div></div></div>' | ||
+ | ); | ||
+ | } | ||
+ | |||
+ | if (!isEmpty(data.functionalityAssays)) { | ||
+ | $('#main').append('<div class="well"><h3>Flow Cytometry Experiment</h3><div class = "container"><div class = "row"><div class = "col-xs-3"><h4>Purpose</h4><div>'+ data.functionalityAssays.Purpose +'</div></div><div class = "col-xs-3"><h4>Type</h4><div>'+data.functionalityAssays.ExperimentType +'</div></div><div class = "col-xs-3"><h4>Location</h4><div>'+data.functionalityAssays.Location +'</div></div><div class = "col-xs-3"><h4>FCS Format</h4><div style = "width:80%">'+data.functionalityAssays.FCSFormat | ||
+ | +'</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Machine Name</h4><div>'+ data.functionalityAssays.MachineName +'</div></div><div class = "col-xs-3"><h4>Protocol Details</h4><div>'+ data.functionalityAssays.FlowProtocolDetails +'</div></div><div class = "col-xs-3"><h4>Link to Protocol</h4><div>'+ data.functionalityAssays.FlowProtocolLink +'</div></div><div class = "col-xs-3"><h4>Laser (filters)</h4><div style = "width:80%">'+data.functionalityAssays.LasersFilters | ||
+ | + '</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Transfer Curve Graph</h4><div><img src="'+data.functionalityAssays.TranserCurve+'" class="img-polaroid" style = "width:80%;"/>'+ '</div></div><div class = "col-xs-3"><h4>Transfer Curve Captions</h4><div>'+ data.functionalityAssays.TranserCurveCaption +'</div></div><div class = "col-xs-3"><h4>Time Series Graph</h4><div><img src="'+data.functionalityAssays.TimeSeriesGraph+'" class="img-polaroid" style = "width:80%;"/></div></div><div class = "col-xs-3"><h4>Time Series Graph Caption</h4><div style = "width:80%">'+data.functionalityAssays.TimeSeriesGraphCaption | ||
+ | + '</div></div></div></div><h4 style = "margin-top:25px;">Pre-Induction Growth Conditions</h4><div class = "container"><div class = "row"><div class = "col-xs-4"><h4>Media Type</h4><div>'+ data.pre.PreMedia +'</div></div><div class = "col-xs-4"><h4>Vessel</h4><div>'+data.pre.PreVessel +'</div></div><div class = "col-xs-4"><h4>Volume</h4><div>'+data.pre.PreVolume | ||
+ | +'</div></div></div><div class = "row"><div class = "col-xs-4"><h4>Incubation Time (min)</h4><div>' + data.pre.PreIncubationTime+'</div></div><div class = "col-xs-4"><h4>Growth Phase</h4><div>'+ data.pre.PreGrowthPhase | ||
+ | +'</div></div></div></div><h4 style = "margin-top:25px;">Post-Induction Growth Conditions</h4><div class = "container"><div class = "row"><div class = "col-xs-4"><h4>Media Type</h4><div>'+ data.post.IndMedia +'</div></div><div class = "col-xs-4"><h4>Vessel</h4><div>'+data.post.IndVessel +'</div></div><div class = "col-xs-4"><h4>Volume</h4><div>'+data.post.IndVolume | ||
+ | +'</div></div></div><div class = "row"><div class = "col-xs-4"><h4>Incubation Time (min)</h4><div>' + data.post.IndIncubationTime+'</div></div><div class = "col-xs-4"><h4>Growth Phase</h4><div>'+ data.post.IndGrowthPhase+'</div></div><div class = "col-xs-4"><h4>Inducer</h4><div>'+data.post.Inducer | ||
+ | +'</div></div></div><div class = "row"><div class = "col-xs-4"><h4>Inducer Concentration</h4><div>' + data.post.InducerConcentration+'</div></div></div>') | ||
+ | |||
+ | |||
+ | |||
+ | /* | ||
+ | '</tbody></table><h5>Pre-Induction Growth Conditions</h5><table><tbody>'+ | ||
+ | '<tr><th align="left">Media Type</th><td>' + data.pre.PreMedia + '</td></tr>' + | ||
+ | '<tr><th align="left">Vessel</th><td>' + data.pre.PreVessel + '</td></tr>' + | ||
+ | '<tr><th align="left">Volume</th><td>' + data.pre.PreVolume + '</td></tr>' + | ||
+ | '<tr><th align="left">Incubation Time (min)</th><td>' + data.pre.PreIncubationTime + '</td></tr>' + | ||
+ | '<tr><th align="left">Growth Phase</th><td>' + data.pre.PreGrowthPhase + '</td></tr>' + | ||
+ | '</tbody></table><h5>Pre-Induction Growth Conditions</h5><table><tbody>'+ | ||
+ | '<tr><th align="left">Media Type</th><td>' + data.post.IndMedia + '</td></tr>' + | ||
+ | '<tr><th align="left">Vessel</th><td>' + data.post.IndVessel + '</td></tr>' + | ||
+ | '<tr><th align="left">Volume</th><td>' + data.post.IndVolume + '</td></tr>' + | ||
+ | '<tr><th align="left">Incubation Time (min)</th><td>' + data.post.IndIncubationTime + '</td></tr>' + | ||
+ | '<tr><th align="left">Growth Phase</th><td>' + data.post.IndGrowthPhase + '</td></tr>' + | ||
+ | '<tr><th align="left">Inducer</th><td>' + data.post.Inducer + '</td></tr>' + | ||
+ | '<tr><th align="left">Inducer Concentrations</th><td>' + data.post.InducerConcentration + '</td></tr>' + | ||
+ | '</div></div>');*/ | ||
+ | |||
+ | } | ||
+ | |||
+ | if (!isEmpty(data.otherAssay)) { | ||
+ | $('#main').append('<div class="well"><h3>Custom Assay</h3><div class = "container"><div class = "row"><div class = "col-xs-3"><h4>Assay Name</h4><div>'+ data.otherAssay.AssayName +'</div></div><div class = "col-xs-3"><h4>Protocol Details</h4><div>'+data.otherAssay.ProtocolDetails +'</div></div><div class = "col-xs-3"><h4>Assay Type</h4><div>'+data.otherAssay.AssayPurpose +'</div></div><div class = "col-xs-3"><h4>Link to Protocol</h4><div style = "width:80%">'+data.otherAssay.ProtocolLink | ||
+ | +'</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Image</h4><div><img src="'+data.otherAssay.AssayImage+'" class="img-polaroid" style = "width:80%;"/></div></div><div class = "col-xs-3"><h4>Image Caption</h4><div>'+ data.otherAssay.AssayImageCaption +'</div></div><div class = "col-xs-3"><h4>Link to Additional Data</h4><div>'+ data.otherAssay.AssayDataLink +'</div></div><div class = "col-xs-3"><h4>Additional Data Details</h4><div style = "width:80%">'+ data.otherAssay.AssayDataDetails | ||
+ | + '</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Parameter 1</h4><div>' + data.otherAssay.Parameter1+'</div></div><div class = "col-xs-3"><h4>Value 1</h4><div>'+ data.otherAssay.Value1 +'</div></div><div class = "col-xs-3"><h4>Parameter 2</h4><div>'+ data.otherAssay.Parameter2 +'</div></div><div class = "col-xs-3"><h4>Value 2</h4><div style = "width:80%">'+data.otherAssay.Value2 | ||
+ | + '</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Parameter 3</h4><div>' + data.otherAssay.Parameter3+'</div></div><div class = "col-xs-3"><h4>Value 3</h4><div>'+ data.otherAssay.Value3 +'</div></div><div class = "col-xs-3"><h4>Additional Comments</h4><div>'+ data.otherAssay.comments +'</div></div>' | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | /*'<div class="well"><h3>Custom Assay</h3><div class="row-fluid"> <table><col width="250"><col width="250"><tbody>'+ | ||
+ | '<tr><th align="left">Assay Name</th><td>' + data.otherAssay.AssayName + '</td> <th align="left">Protocol Details</th><td>' + data.otherAssay.ProtocolDetails + '</td></tr>' + | ||
+ | '<tr><th align="left">Assay Type</th><td>' + data.otherAssay.AssayPurpose + '</td> <th align="left">Link to Protocol</th><td>' + data.otherAssay.ProtocolLink + '</td></tr>' + | ||
+ | '<tr><th align="left">Link to Image</th><td>' + data.otherAssay.AssayImage + '</td> <th align="left">Image Caption</th><td>' + data.otherAssay.AssayImageCaption + '</td></tr>' + | ||
+ | '<tr><th align="left">Link to Additional Data</th><td>' + data.otherAssay.AssayDataLink + '</td> <th align="left">Additional Data Details</th><td>' + data.otherAssay.AssayDataDetails + '</td></tr>' + | ||
+ | '<tr><th align="left">Parameter 1</th><td>' + data.otherAssay.Parameter1 + '</td> <th align="left">Value 1</th><td>' + data.otherAssay.Value1 + '</td></tr>' + | ||
+ | '<tr><th align="left">Parameter 2</th><td>' + data.otherAssay.Parameter2 + '</td> <th align="left">Value 2</th><td>' + data.otherAssay.Value2 + '</td></tr>' + | ||
+ | '<tr><th align="left">Parameter 3</th><td>' + data.otherAssay.Parameter3 + '</td> <th align="left">Value 3</th><td>' + data.otherAssay.Value3 + '</td></tr>' + | ||
+ | '</tbody></table></div></div>'*/); | ||
+ | } | ||
+ | }); | ||
+ | </script> | ||
+ | |||
+ | <!--<script>$('div.well:empty').hide(); </script>--> | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | </body></html> |
Revision as of 01:24, 30 April 2014
Automatically build Datasheets
BBa_E1010
Part Description
Summary
**highly** engineered mutant of red fluorescent protein from Discosoma striata (coral)
Sequence
atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagtt cgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgc tgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccg gactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgt tacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc cggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaa atcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggt tcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagt acgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc