|
|
Line 1: |
Line 1: |
− | <html><head>
| |
− | <style>
| |
− | div{
| |
− | word-wrap:break-word;
| |
− | }
| |
− | </style>
| |
− | <title class="name">BBa_E1010</title>
| |
− | <link rel="shortcut icon" href="images/logo-Owl-Color_cropped.ico">
| |
− | <link href="//netdna.bootstrapcdn.com/bootstrap/3.1.1/css/bootstrap.min.css" rel="stylesheet">
| |
− | <link rel="stylesheet" type="text/css" media="print" href="//netdna.bootstrapcdn.com/bootstrap/3.1.1/css/bootstrap.min.css">
| |
− | <meta http-equiv="Content-Type" content="text/html; charset=UTF-8">
| |
− | <style type="text/css"></style></head>
| |
− | <body class="container" id="main" style="padding-top: 10px;">
| |
− | <h1><img style="width: 48px; height: 40px; margin-top:2px" src="images/logo-Owl-Color_cropped.png"><small> Automatically build Datasheets</small></h1>
| |
− | <!--summary-->
| |
− | <div class="well" id="basicInformation">
| |
| | | |
− | <h1 class="name">BBa_E1010</h1>
| |
− | <h3>Part Description</h3>
| |
− | <div class="container">
| |
− | <div class="row">
| |
− | <div class="col-xs-6">
| |
− |
| |
− |
| |
− | <h4>Summary</h4>
| |
− | <p id="summary">**highly** engineered mutant of red fluorescent protein from Discosoma striata (coral)</p>
| |
− | </div>
| |
− | <div class="col-xs-6">
| |
− |
| |
− | <h4>Sequence</h4>
| |
− | <p id="sequence" style="width:80%;word-wrap: break-word;">atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagtt cgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgc tgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccg gactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgt tacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc cggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaa atcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggt tcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagt acgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc</p>
| |
− | </div>
| |
− | </div>
| |
− | <div class="row">
| |
− |
| |
− | <div class="col-xs-6">
| |
− |
| |
− | <h4>Pigeon Image</h4>
| |
− | <div class="row-fluid span6" id="deviceImage"><img src="" class="img-polaroid" style="width:80%;"></div>
| |
− | </div>
| |
− |
| |
− | <div class="col-xs-6">
| |
− | <h4>Plasmid Map</h4>
| |
− |
| |
− | <div class="row-fluid span6" id="plasmidMap"><img src="" class="img-polaroid" style="width:80%;"></div>
| |
− |
| |
− | </div>
| |
− | </div>
| |
− | <div class="row">
| |
− | <div class="col-xs-6">
| |
− | <h4> Part Type </h4>
| |
− |
| |
− | <div id="partType">
| |
− | Basic Part
| |
− | </div>
| |
− |
| |
− |
| |
− | </div>
| |
− | <div class="col-xs-6">
| |
− | <h4> Related Parts </h4>
| |
− |
| |
− | <div id="relatedParts" style="width:80%"></div>
| |
− |
| |
− | </div>
| |
− |
| |
− |
| |
− | </div>
| |
− |
| |
− | </div>
| |
− | </div>
| |
− |
| |
− | <div class="well" id="designerInfo">
| |
− | <h3>Designer Information</h3>
| |
− | <div class="container">
| |
− | <div class="row">
| |
− | <div class="col-xs-4"><h4>Author(s)</h4><div id="authors">Drew Endy</div></div>
| |
− | <div class="col-xs-4"><h4>Data Collectors</h4><div id="dataCollection"></div></div>
| |
− | <div class="col-xs-4"><h4>Date</h4><div id="date" style="width:80%">2004-07-28</div></div>
| |
− | </div>
| |
− | <div class="row">
| |
− | <div class="col-xs-4"><h4>Affiliation</h4><div id="affiliation"></div></div>
| |
− | <div class="col-xs-4"><h4>Team</h4><div id="team"></div></div>
| |
− | <div class="col-xs-4"><h4>Contact</h4><div id="contact" style="width:80%"></div></div>
| |
− | </div>
| |
− |
| |
− | </div>
| |
− |
| |
− | </div>
| |
− |
| |
− |
| |
− | <div class="well" id="designDetails">
| |
− |
| |
− | <h3>Designer Details</h3>
| |
− | <div class="container">
| |
− | <div class="row">
| |
− | <div class="col-xs-3"><h4>Type</h4><div id="type"></div></div>
| |
− | <div class="col-xs-3"><h4>Vector</h4><div id="vector"></div></div>
| |
− | <div class="col-xs-3"><h4>Design Components</h4><div id="designComponents"></div></div>
| |
− | <div class="col-xs-3"><h4>Additional Comments</h4><div id="designComments" style="width:80%"></div></div>
| |
− | </div>
| |
− |
| |
− | </div>
| |
− |
| |
− | </div>
| |
− |
| |
− |
| |
− | <div class="well" id="assemblyInformation">
| |
− | <h3>Assembly Information</h3>
| |
− | <div class="container">
| |
− | <div class="row">
| |
− | <div class="col-xs-3"><h4>Assembly Method(s)</h4><div id="assemblyMethod"></div></div>
| |
− | <div class="col-xs-3"><h4>Chassis</h4><div id="chassis"></div></div>
| |
− | <div class="col-xs-3"><h4>Assembly RFC</h4><div id="assemblyRFC"></div></div>
| |
− | <div class="col-xs-3"><h4>Strain</h4><div id="strain" style="width:80%"></div></div>
| |
− | </div>
| |
− | <div class="row">
| |
− |
| |
− | <div class="col-xs-3"><h4>Scars (y/n)</h4><div id="assemblyScars"></div></div>
| |
− | <div class="col-xs-3"><h4>Additional Comments</h4><div id="assemblyComments"></div></div>
| |
− | <div class="col-xs-3"><h4>Assembly Components</h4><div id="assemblyComponents" style="width:80%"></div></div>
| |
− |
| |
− | </div>
| |
− | <div class="row">
| |
− |
| |
− | <div class="col-xs-6"><h4>Assembly Graph</h4><div id="assemblyImage"><img src="" class="img-polaroid" style="width:80%;"></div></div>
| |
− | </div>
| |
− |
| |
− | </div>
| |
− |
| |
− | </div>
| |
− |
| |
− | <script src="//ajax.googleapis.com/ajax/libs/jquery/2.0.3/jquery.min.js"></script>
| |
− | <script src="//netdna.bootstrapcdn.com/bootstrap/3.0.0/js/bootstrap.min.js"></script>
| |
− | <script>
| |
− | $.get("DataServlet", function(data) {
| |
− |
| |
− |
| |
− | console.log(data);
| |
− | // a function to check is an entire field is empty
| |
− | var hasOwnProperty = Object.prototype.hasOwnProperty;
| |
− |
| |
− | function isEmpty(obj) {
| |
− |
| |
− | // null and undefined are "empty"
| |
− | if (obj == null) return true;
| |
− |
| |
− | // Assume if it has a length property with a non-zero value
| |
− | // that that property is correct.
| |
− | //if (obj.length > 0) return false;
| |
− | if (obj.length === 0) return true;
| |
− |
| |
− | // Otherwise, does it have any properties of its own?
| |
− | // Note that this doesn't handle
| |
− | // toString and valueOf enumeration bugs in IE < 9
| |
− | for (var key in obj) {
| |
− | if (hasOwnProperty.call(obj, key)) return false;
| |
− | }
| |
− |
| |
− | return true;
| |
− | }
| |
− |
| |
− | //console.log(data);
| |
− | $(".name").text(data.name);
| |
− | $("#summary").text(data.summary);
| |
− | $("#sequence").text(data.sequence);
| |
− | $("#partType").text(data.partType);
| |
− | $("#relatedParts").text(data.relatedParts);
| |
− | $("#deviceImage img").attr('src', data.deviceImage);
| |
− | $("#plasmidMap img").attr('src', data.plasmidMap);
| |
− |
| |
− |
| |
− | //Contact Info
| |
− | $("#authors").text(data.contactInformation.authors);
| |
− | $("#team").text(data.contactInformation.team);
| |
− | $("#dataCollection").text(data.contactInformation.dataCollection);
| |
− | $("#affiliation").text(data.contactInformation.affiliation);
| |
− | $("#date").text(data.contactInformation.date);
| |
− | $("#contact").text(data.contactInformation.contact);
| |
− |
| |
− | //Design Detail
| |
− | //console.log(data.designDetails);
| |
− | $("#type").text(data.designDetails.type);
| |
− | $("#vector").text(data.designDetails.vector);
| |
− | $("#designComponents").text(data.designDetails.designComponents);
| |
− | $("#designComments").text(data.designDetails.designComments);
| |
− |
| |
− | //Assembly
| |
− | $("#assemblyMethod").text(data.assemblyInformation.assemblyMethod);
| |
− | $("#chassis").text(data.assemblyInformation.chassis);
| |
− | $("#assemblyRFC").text(data.assemblyInformation.assemblyRFC);
| |
− | $("#assemblyScars").text(data.assemblyInformation.assemblyScars);
| |
− | $("#assemblyComponents").text(data.assemblyInformation.assemblyComponents);
| |
− | $("#chasis").text(data.assemblyInformation.chasis);
| |
− | $("#strain").text(data.assemblyInformation.strain);
| |
− | $("#assemblyComments").text(data.assemblyInformation.assemblyComments);
| |
− | $("#assemblyImage img").attr('src', data.assemblyImage);
| |
− |
| |
− | //Assay Table
| |
− |
| |
− | // var rmap = data.restrictionMap;
| |
− |
| |
− | if (!isEmpty(data.restrictionMap)) {
| |
− | $('#main').append('<div class="well"><h3>Restriction Map</h3><div class = "container"><div class = "row"><div class = "col-xs-3"><h4>Gel Buffer</h4><div>'+ data.restrictionMap.GelBuffer +'</div></div><div class = "col-xs-3"><h4>DNA Quality</h4><div>'+data.restrictionMap.DNAQuantity +'</div></div><div class = "col-xs-3"><h4>Percent Agar</h4><div>'+data.restrictionMap.Agar +'</div></div><div class = "col-xs-3"><h4>Enzymes</h4><div style = "width:80%">'+data.restrictionMap.Enzymes
| |
− | +'</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Ladder</h4><div>'+ data.restrictionMap.Ladder +'</div></div><div class = "col-xs-3"><h4>Digest Buffer</h4><div>'+data.restrictionMap.DigestBuffer +'</div></div><div class = "col-xs-3"><h4>Staining Dye</h4><div>'+data.restrictionMap.StainingDye +'</div></div><div class = "col-xs-3"><h4>Digest Time</h4><div style = "width:80%">'+data.restrictionMap.DigestTime
| |
− | + '</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Voltage</h4><div>'+ data.restrictionMap.Voltage +'</div></div><div class = "col-xs-3"><h4>Gel Image</h4><div><img src="'+data.restrictionMap.Image+'" class="img-polaroid" style = "width:80%;"/>'+ '</div></div><div class = "col-xs-3"><h4>Time</h4><div>'+data.restrictionMap.Time +'</div></div><div class = "col-xs-3"><h4>Caption for Image</h4><div style = "width:80%">'+data.restrictionMap.Caption
| |
− | + '</div></div></div>'
| |
− | );
| |
− | }
| |
− |
| |
− | if (!isEmpty(data.functionalityAssays)) {
| |
− | $('#main').append('<div class="well"><h3>Flow Cytometry Experiment</h3><div class = "container"><div class = "row"><div class = "col-xs-3"><h4>Purpose</h4><div>'+ data.functionalityAssays.Purpose +'</div></div><div class = "col-xs-3"><h4>Type</h4><div>'+data.functionalityAssays.ExperimentType +'</div></div><div class = "col-xs-3"><h4>Location</h4><div>'+data.functionalityAssays.Location +'</div></div><div class = "col-xs-3"><h4>FCS Format</h4><div style = "width:80%">'+data.functionalityAssays.FCSFormat
| |
− | +'</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Machine Name</h4><div>'+ data.functionalityAssays.MachineName +'</div></div><div class = "col-xs-3"><h4>Protocol Details</h4><div>'+ data.functionalityAssays.FlowProtocolDetails +'</div></div><div class = "col-xs-3"><h4>Link to Protocol</h4><div>'+ data.functionalityAssays.FlowProtocolLink +'</div></div><div class = "col-xs-3"><h4>Laser (filters)</h4><div style = "width:80%">'+data.functionalityAssays.LasersFilters
| |
− | + '</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Transfer Curve Graph</h4><div><img src="'+data.functionalityAssays.TranserCurve+'" class="img-polaroid" style = "width:80%;"/>'+ '</div></div><div class = "col-xs-3"><h4>Transfer Curve Captions</h4><div>'+ data.functionalityAssays.TranserCurveCaption +'</div></div><div class = "col-xs-3"><h4>Time Series Graph</h4><div><img src="'+data.functionalityAssays.TimeSeriesGraph+'" class="img-polaroid" style = "width:80%;"/></div></div><div class = "col-xs-3"><h4>Time Series Graph Caption</h4><div style = "width:80%">'+data.functionalityAssays.TimeSeriesGraphCaption
| |
− | + '</div></div></div></div><h4 style = "margin-top:25px;">Pre-Induction Growth Conditions</h4><div class = "container"><div class = "row"><div class = "col-xs-4"><h4>Media Type</h4><div>'+ data.pre.PreMedia +'</div></div><div class = "col-xs-4"><h4>Vessel</h4><div>'+data.pre.PreVessel +'</div></div><div class = "col-xs-4"><h4>Volume</h4><div>'+data.pre.PreVolume
| |
− | +'</div></div></div><div class = "row"><div class = "col-xs-4"><h4>Incubation Time (min)</h4><div>' + data.pre.PreIncubationTime+'</div></div><div class = "col-xs-4"><h4>Growth Phase</h4><div>'+ data.pre.PreGrowthPhase
| |
− | +'</div></div></div></div><h4 style = "margin-top:25px;">Post-Induction Growth Conditions</h4><div class = "container"><div class = "row"><div class = "col-xs-4"><h4>Media Type</h4><div>'+ data.post.IndMedia +'</div></div><div class = "col-xs-4"><h4>Vessel</h4><div>'+data.post.IndVessel +'</div></div><div class = "col-xs-4"><h4>Volume</h4><div>'+data.post.IndVolume
| |
− | +'</div></div></div><div class = "row"><div class = "col-xs-4"><h4>Incubation Time (min)</h4><div>' + data.post.IndIncubationTime+'</div></div><div class = "col-xs-4"><h4>Growth Phase</h4><div>'+ data.post.IndGrowthPhase+'</div></div><div class = "col-xs-4"><h4>Inducer</h4><div>'+data.post.Inducer
| |
− | +'</div></div></div><div class = "row"><div class = "col-xs-4"><h4>Inducer Concentration</h4><div>' + data.post.InducerConcentration+'</div></div></div>')
| |
− |
| |
− |
| |
− |
| |
− | /*
| |
− | '</tbody></table><h5>Pre-Induction Growth Conditions</h5><table><tbody>'+
| |
− | '<tr><th align="left">Media Type</th><td>' + data.pre.PreMedia + '</td></tr>' +
| |
− | '<tr><th align="left">Vessel</th><td>' + data.pre.PreVessel + '</td></tr>' +
| |
− | '<tr><th align="left">Volume</th><td>' + data.pre.PreVolume + '</td></tr>' +
| |
− | '<tr><th align="left">Incubation Time (min)</th><td>' + data.pre.PreIncubationTime + '</td></tr>' +
| |
− | '<tr><th align="left">Growth Phase</th><td>' + data.pre.PreGrowthPhase + '</td></tr>' +
| |
− | '</tbody></table><h5>Pre-Induction Growth Conditions</h5><table><tbody>'+
| |
− | '<tr><th align="left">Media Type</th><td>' + data.post.IndMedia + '</td></tr>' +
| |
− | '<tr><th align="left">Vessel</th><td>' + data.post.IndVessel + '</td></tr>' +
| |
− | '<tr><th align="left">Volume</th><td>' + data.post.IndVolume + '</td></tr>' +
| |
− | '<tr><th align="left">Incubation Time (min)</th><td>' + data.post.IndIncubationTime + '</td></tr>' +
| |
− | '<tr><th align="left">Growth Phase</th><td>' + data.post.IndGrowthPhase + '</td></tr>' +
| |
− | '<tr><th align="left">Inducer</th><td>' + data.post.Inducer + '</td></tr>' +
| |
− | '<tr><th align="left">Inducer Concentrations</th><td>' + data.post.InducerConcentration + '</td></tr>' +
| |
− | '</div></div>');*/
| |
− |
| |
− | }
| |
− |
| |
− | if (!isEmpty(data.otherAssay)) {
| |
− | $('#main').append('<div class="well"><h3>Custom Assay</h3><div class = "container"><div class = "row"><div class = "col-xs-3"><h4>Assay Name</h4><div>'+ data.otherAssay.AssayName +'</div></div><div class = "col-xs-3"><h4>Protocol Details</h4><div>'+data.otherAssay.ProtocolDetails +'</div></div><div class = "col-xs-3"><h4>Assay Type</h4><div>'+data.otherAssay.AssayPurpose +'</div></div><div class = "col-xs-3"><h4>Link to Protocol</h4><div style = "width:80%">'+data.otherAssay.ProtocolLink
| |
− | +'</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Image</h4><div><img src="'+data.otherAssay.AssayImage+'" class="img-polaroid" style = "width:80%;"/></div></div><div class = "col-xs-3"><h4>Image Caption</h4><div>'+ data.otherAssay.AssayImageCaption +'</div></div><div class = "col-xs-3"><h4>Link to Additional Data</h4><div>'+ data.otherAssay.AssayDataLink +'</div></div><div class = "col-xs-3"><h4>Additional Data Details</h4><div style = "width:80%">'+ data.otherAssay.AssayDataDetails
| |
− | + '</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Parameter 1</h4><div>' + data.otherAssay.Parameter1+'</div></div><div class = "col-xs-3"><h4>Value 1</h4><div>'+ data.otherAssay.Value1 +'</div></div><div class = "col-xs-3"><h4>Parameter 2</h4><div>'+ data.otherAssay.Parameter2 +'</div></div><div class = "col-xs-3"><h4>Value 2</h4><div style = "width:80%">'+data.otherAssay.Value2
| |
− | + '</div></div></div><div class = "row"><div class = "col-xs-3"><h4>Parameter 3</h4><div>' + data.otherAssay.Parameter3+'</div></div><div class = "col-xs-3"><h4>Value 3</h4><div>'+ data.otherAssay.Value3 +'</div></div><div class = "col-xs-3"><h4>Additional Comments</h4><div>'+ data.otherAssay.comments +'</div></div>'
| |
− |
| |
− |
| |
− |
| |
− |
| |
− | /*'<div class="well"><h3>Custom Assay</h3><div class="row-fluid"> <table><col width="250"><col width="250"><tbody>'+
| |
− | '<tr><th align="left">Assay Name</th><td>' + data.otherAssay.AssayName + '</td> <th align="left">Protocol Details</th><td>' + data.otherAssay.ProtocolDetails + '</td></tr>' +
| |
− | '<tr><th align="left">Assay Type</th><td>' + data.otherAssay.AssayPurpose + '</td> <th align="left">Link to Protocol</th><td>' + data.otherAssay.ProtocolLink + '</td></tr>' +
| |
− | '<tr><th align="left">Link to Image</th><td>' + data.otherAssay.AssayImage + '</td> <th align="left">Image Caption</th><td>' + data.otherAssay.AssayImageCaption + '</td></tr>' +
| |
− | '<tr><th align="left">Link to Additional Data</th><td>' + data.otherAssay.AssayDataLink + '</td> <th align="left">Additional Data Details</th><td>' + data.otherAssay.AssayDataDetails + '</td></tr>' +
| |
− | '<tr><th align="left">Parameter 1</th><td>' + data.otherAssay.Parameter1 + '</td> <th align="left">Value 1</th><td>' + data.otherAssay.Value1 + '</td></tr>' +
| |
− | '<tr><th align="left">Parameter 2</th><td>' + data.otherAssay.Parameter2 + '</td> <th align="left">Value 2</th><td>' + data.otherAssay.Value2 + '</td></tr>' +
| |
− | '<tr><th align="left">Parameter 3</th><td>' + data.otherAssay.Parameter3 + '</td> <th align="left">Value 3</th><td>' + data.otherAssay.Value3 + '</td></tr>' +
| |
− | '</tbody></table></div></div>'*/);
| |
− | }
| |
− | });
| |
− | </script>
| |
− |
| |
− | <!--<script>$('div.well:empty').hide(); </script>-->
| |
− |
| |
− |
| |
− |
| |
− |
| |
− | </body></html>
| |