Difference between revisions of "Part:BBa K823035"

(Methods)
Line 66: Line 66:
 
Rabbit anti-HA (1:500, Sigma, H6908) in TBS, 0.05% (w/v) Tween20, 5% (w/v) skim milk powder and anti-rabbit-HRP (1:2000, Promega, W401B) in Blotto-buffer were used.  
 
Rabbit anti-HA (1:500, Sigma, H6908) in TBS, 0.05% (w/v) Tween20, 5% (w/v) skim milk powder and anti-rabbit-HRP (1:2000, Promega, W401B) in Blotto-buffer were used.  
  
 +
 +
Chemiluminescence signals were detected after addition of the HRP-substrate Ace Glow (Peqlab, Erlangen, Germany) using a Fusion<sup>TM</sup> imaging system (Peqlab). 
  
  

Revision as of 12:25, 3 February 2014

HA-tag (Freiburg standard+RBS)

HA-tag with RBS in Freiburg standard.

Find out more about the design of our prefix with ribosome binding site.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

The HA-tag is an epitope derived from the HA-virus. There was first an antibody against it and then the epitope was characterized ([http://www.ncbi.nlm.nih.gov/pubmed/6204768 Wilson, I.A. et al. (1984)]). It was then furthermore used as a tag for protein purification and recognition ([http://www.ncbi.nlm.nih.gov/pubmed/2455217 Field, J. et al. (1988)]). The aminoacid sequence is: YPYDVPDYA.


This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

  • HA - tag


Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Evaluation

All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in Bacillus subtils using pSBBs0K-Pspac. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene.

LMU-Western Blot Tags.png

Fig. 1: Western blots of N- and C-terminal fusions of each tag to GFP, using the strains TMB1920 (Flag-gfp), TMB1921 (gfp-Flag), TMB1922 (HA-gfp), TMB1923 (gfp-HA), TMB1924 (cMyc-gfp), TMB1925 (gfp-cMyc), TMB1926 (His-gfp), TMB1927 (gfp-His), TMB1928 (StrepII-gfp) and TMB1929 (gfp-StrepII). For each construct, two independent clones were tested with epitope tag- and GFP-specific antibodies as a positive control.

Methods

To verify the functionality of the epitope tags, Western blot analyses of the strains TMB1920-TMB1929 were performed. LB medium (15 ml) was inoculated 1:100 from overnight culture and grown at 37°C and 200 rpm to OD600 ~ 0.5. Of this, 10 ml were harvested by centrifugation (8000 × g, 5 min) and the pellets stored at -20°C. Pellets were resuspended in 1 ml disruption buffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl) and lysed by sonication. Samples (12 μl of lysate) were loaded per lane on two 12.5% SDS-polyacrylamide gels and SDS-PAGE was performed according standard procedure [60]. One gel was stained with colloidal coomassie, the other one was used for protein transfer to a PVDF membrane (Merck Millipore, Billerica, MA, USA) by submerged blotting procedure (Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA, USA)). After protein transfer, the membranes were treated with the following antibodies and conditions. Detailed protocols can be found [http://www.jbioleng.org/content/7/1/29/suppl/S3 here]


GFP

Probing with primary antibodies takes place with rabbit anti-GFP antibodies (1:3000, Epitomics, No. 1533). Horseradish-peroxidase (HRP)-conjugated anti-rabbit antibodies (1:2000, Promega, W401B) were used as secondary antibody. Hybridization of both antibodies was carried out in Blotto-buffer (2.5% (w/v) skim milk powder, 1 × TBS (50 mM Tris–HCl pH 7.6, 0.15 M NaCl)).


HA

Rabbit anti-HA (1:500, Sigma, H6908) in TBS, 0.05% (w/v) Tween20, 5% (w/v) skim milk powder and anti-rabbit-HRP (1:2000, Promega, W401B) in Blotto-buffer were used.


Chemiluminescence signals were detected after addition of the HRP-substrate Ace Glow (Peqlab, Erlangen, Germany) using a FusionTM imaging system (Peqlab).


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]