Difference between revisions of "Part:BBa K1104100:Experience"
JosephHuang (Talk | contribs) |
|||
| Line 34: | Line 34: | ||
5.run HPLC and compare it with the two standard line of only 2-O-(6-phospho-α-D-mannosyl)-D-glycerate and with only the extraction liquid of ''E. coli'' cytoplasm <br> | 5.run HPLC and compare it with the two standard line of only 2-O-(6-phospho-α-D-mannosyl)-D-glycerate and with only the extraction liquid of ''E. coli'' cytoplasm <br> | ||
6.compare the area of the data lines with the area of the standard line to calculate the efficiency of the alpha-mannosidase produced by ''E. coli'' | 6.compare the area of the data lines with the area of the standard line to calculate the efficiency of the alpha-mannosidase produced by ''E. coli'' | ||
| − | + | [[File:NYMU_mngB.png|50px|right]] | |
| + | '''mngB clonning result'''<br> | ||
| + | Before doing the functional test, it is a must that we have to construct a circuit that can constitutively produce alpha-mannosidase. We have added a constitutive promoter, BBa_J23102,at the upper stream of the mngB coding sequenceand terminator behind the gene. The whole length is 3,146bp. In the right well of the picture at the right is the marker and the left is our part, which shows that the insert of mngB with promoter, RBS and terminator is correct, showing that we have successfully finish our circuit. | ||
===User Reviews=== | ===User Reviews=== | ||
<!-- DON'T DELETE --><partinfo>BBa_K1104100 StartReviews</partinfo> | <!-- DON'T DELETE --><partinfo>BBa_K1104100 StartReviews</partinfo> | ||
Revision as of 06:46, 30 October 2013
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K1104100
Experiment
alpha mannosidase primer:
Since the mngB comes direct from E. coli substrain MG1655, we have designed a primer to clone from the whole genome of MG1655.The primer we used is listed below:
| primer sequence | whole primer temp. | binding part temp. | GC% | |
|---|---|---|---|---|
| forward: | ctg GAATTCGCGGCCGCTTCTAG atgAAAGCAGTATCTCGCGTTCACATCACCCCG | 76℃ | 68℃ | 55% |
| reverse: | gga CTGCAGCGGCCGCTACTAGTA tcaGGCAAGCCGGTAACTGAACGTCCG | 76℃ | 68℃ | 58% |
mannosidase function test
After cloning the mngB gene into the E. coli, we would want to know whether our part work. So we decided to extract alpha-mannosidase from the cytoplasm of the E. coli and test its function by directly interact with 2-O-(6-phospho-α-D-mannosyl)-D-glycerate, and through HPLC to see if it can successfully turn it into α-D-mannose-6-phosphate and D-glycerate.Experimental process is listed below:
1.use Continuous High Pressure Cell Disrupter to crush the E. coli that produce alpha-mannosidase
2.filter the product and save the filtrate in a eppendorf
3.add 2-O-(6-phospho-α-D-mannosyl)-D-glycerate into eppendorf
4.incubate at 25℃ for 30 min.
5.run HPLC and compare it with the two standard line of only 2-O-(6-phospho-α-D-mannosyl)-D-glycerate and with only the extraction liquid of E. coli cytoplasm
6.compare the area of the data lines with the area of the standard line to calculate the efficiency of the alpha-mannosidase produced by E. coli
mngB clonning result
Before doing the functional test, it is a must that we have to construct a circuit that can constitutively produce alpha-mannosidase. We have added a constitutive promoter, BBa_J23102,at the upper stream of the mngB coding sequenceand terminator behind the gene. The whole length is 3,146bp. In the right well of the picture at the right is the marker and the left is our part, which shows that the insert of mngB with promoter, RBS and terminator is correct, showing that we have successfully finish our circuit.
User Reviews
UNIQ713db8524ba202f0-partinfo-00000000-QINU UNIQ713db8524ba202f0-partinfo-00000001-QINU