Difference between revisions of "Part:BBa K1159003"

Revision as of 15:06, 12 October 2013

Engineered Fluorescein-Binding Anticalin FluA (triple mutant variant) in RFC[25]

Engineered version (triple mutant) of fluorescein-binding anticalin FluA with high binding affinity for fluorescein. This part is flanked by RFC[25] pre- and suffix for further protein fusions. This is an improved version of BBa_K157004.

The fluoresceine binding Anticalin FluA was in 2013 already present in the Parts Registry in RFC 25. As this BioBrick is from 2008 we used a higher engineered variant with three additional mutations which make it 75-times more affine to fluorescein (KD from 152 nM to 2 nM). This seemed an imporatant point as this Anticalin was twice present in the finals of iGEM (Freiburg Team 2008 and 2009) and an improved variant may be helpful for further iGEM teams as well as for our purpose to use it as a binding protein on trangenic moss. The outdated FluA with a lower affinity was BBa_K157004.

Usage and Biology

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
INCOMPATIBLE WITH RFC[21]
Illegal BglII site found at 248
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

Protein data table for BioBrick BBa_ automatically created by the BioBrick-AutoAnnotator version 1.0

Nucleotide sequence in RFC 25 N-Part using the stop codon in the suffix, so ACCGGT was added (in italics) to the 3' end: (underlined part encodes the protein)
AGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGACG ... AGGGTGAAGACCGGT
ORF from nucleotide position 53 to 106 (excluding stop-codon)

Amino acid sequence: (RFC 25 scars in shown in bold, other sequence features underlined; both given below)

1	MVTLMGTNFLSVERVKTG*

Sequence features: (with their position in the amino acid sequence, see the list of supported features)

None of the supported features appeared in the sequence

Amino acid composition:

Ala (A)	0 (0.0%)
Arg (R)	1 (5.6%)
Asn (N)	1 (5.6%)
Asp (D)	0 (0.0%)

Cys (C)	0 (0.0%)
Gln (Q)	0 (0.0%)
Glu (E)	1 (5.6%)
Gly (G)	2 (11.1%)

His (H)	0 (0.0%)
Ile (I)	0 (0.0%)
Leu (L)	2 (11.1%)
Lys (K)	1 (5.6%)

Met (M)	2 (11.1%)
Phe (F)	1 (5.6%)
Pro (P)	0 (0.0%)
Ser (S)	1 (5.6%)

Thr (T)	3 (16.7%)
Trp (W)	0 (0.0%)
Tyr (Y)	0 (0.0%)
Val (V)	3 (16.7%)

Amino acid counting

	Total number:	18
	Positively charged (Arg+Lys):	2 (11.1%)
	Negatively charged (Asp+Glu):	1 (5.6%)
	Aromatic (Phe+His+Try+Tyr):	1 (5.6%)

Biochemical parameters

	Atomic composition:	C₈₆H₁₄₇N₂₃O₂₆S₂
	Molecular mass [Da]:	1983.4
	Theoretical pI:	8.50
	Extinction coefficient at 280 nm [M^-1 cm^-1]:	0 / 0 (all Cys red/ox)

Plot for hydrophobicity, charge, predicted secondary structure, solvent accessability, transmembrane helices and disulfid bridges

Codon usage

	Organism:	E. coli	B. subtilis	S. cerevisiae	A. thaliana	P. patens	Mammals
	Codon quality (CAI):	good (0.74)	good (0.75)	good (0.61)	good (0.68)	excellent (0.83)	good (0.74)

Alignments (obtained from PredictProtein.org)
There were no alignments for this protein in the data base. The BLAST search was initialized and should be ready in a few hours.

Predictions (obtained from PredictProtein.org)

There were no predictions for this protein in the data base. The prediction was initialized and should be ready in a few hours.

The BioBrick-AutoAnnotator was created by TU-Munich 2013 iGEM team. For more information please see the documentation.
If you have any questions, comments or suggestions, please leave us a comment.

@@ Line 3: / Line 3: @@
 Engineered version (triple mutant) of fluorescein-binding anticalin FluA with high binding affinity for fluorescein. This part is flanked by RFC[25] pre- and suffix for further protein fusions. This is an improved version of <partinfo>BBa_K157004</partinfo>.
+The fluoresceine binding Anticalin FluA was in 2013 already present in the Parts Registry in RFC 25. As this BioBrick is from 2008 we used a higher engineered variant with three additional mutations which make it 75-times more affine to fluorescein (KD from 152 nM to 2 nM). This seemed an imporatant point as this Anticalin was twice present in the finals of iGEM (Freiburg Team 2008 and 2009) and an improved variant may be helpful for further iGEM teams as well as for our purpose to use it as a binding protein on trangenic moss. The outdated FluA with a lower affinity was BBa_K157004.
 ===Usage and Biology===