Difference between revisions of "Part:BBa K1111013:Design"
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
To assemble this part, we orderd a plasmid containing the streptavidin dead. Three point mutations have been made, N23A,S27D,S45A, in order to decrease the biotin-streptavidin Kd. This streptavidin is monovalent. | To assemble this part, we orderd a plasmid containing the streptavidin dead. Three point mutations have been made, N23A,S27D,S45A, in order to decrease the biotin-streptavidin Kd. This streptavidin is monovalent. | ||
− | We amplified only the coding sequence of streptavidin of the plasmid by PCR. Also, we did a PCR with overlapping ends corresponding to streptavidin on the Biobrick BBa_K523013 (INP fused with YFP). This PCR was keeping all the plasmid including RBS and Lac promoter but excluding YFP. The linearized plasmid and the insert were then assembled by Gibson assembly. | + | We amplified only the coding sequence of streptavidin of the plasmid by PCR. Also, we did a PCR with overlapping ends corresponding to streptavidin on the '''Biobrick BBa_K523013''' (INP fused with YFP). This PCR was keeping all the plasmid including RBS and Lac promoter but excluding YFP. The linearized plasmid and the insert were then assembled by Gibson assembly. |
===Primers=== | ===Primers=== | ||
Line 24: | Line 24: | ||
===References and acknowledgements=== | ===References and acknowledgements=== | ||
− | Thanks to the Mark Howarth laboratory at Oxford university Dept. of Biochemistry (link), that provided us the plasmid containing the sequence of streptavidin dead. | + | Thanks to the '''Mark Howarth laboratory at Oxford university Dept. of Biochemistry''' (link), that provided us the plasmid containing the sequence of streptavidin dead. |
− | Thanks also to the iGEM team of Edinburgh 2011 that designed the Biobrick BBa_K523013. | + | Thanks also to the '''iGEM team of Edinburgh 2011''' that designed the Biobrick BBa_K523013. |
Revision as of 10:46, 2 October 2013
Ice Nucleation Protein fused to Streptavidin Dead
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 1727
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 1727
- 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 1727
Illegal NgoMIV site found at 1036
Illegal AgeI site found at 1691
Illegal AgeI site found at 1742 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
To assemble this part, we orderd a plasmid containing the streptavidin dead. Three point mutations have been made, N23A,S27D,S45A, in order to decrease the biotin-streptavidin Kd. This streptavidin is monovalent. We amplified only the coding sequence of streptavidin of the plasmid by PCR. Also, we did a PCR with overlapping ends corresponding to streptavidin on the Biobrick BBa_K523013 (INP fused with YFP). This PCR was keeping all the plasmid including RBS and Lac promoter but excluding YFP. The linearized plasmid and the insert were then assembled by Gibson assembly.
Primers
PCR of streptavidin dead : 5' ATGGCTGAAGCTGGTATCACC 3' 5' TTAGGAAGCAGCGGACGGTTTAAC 3'
Overlapping PCR of BBa_K523013 : 5' accaaagttaaaccgtccgctgcttcctaacatatcataacggagtgatcgcaatg 3' 5' ccaggtgccggtgataccagcttcagcCATagatcccgccacgctgct 3'
Source
Can be expressed in Escherichia Coli
References and acknowledgements
Thanks to the Mark Howarth laboratory at Oxford university Dept. of Biochemistry (link), that provided us the plasmid containing the sequence of streptavidin dead. Thanks also to the iGEM team of Edinburgh 2011 that designed the Biobrick BBa_K523013.