Difference between revisions of "Part:BBa K1150028"

Revision as of 11:02, 1 October 2013

uniCAS Red Light Switch Part II - Histone Modifier

This device together with [https://parts.igem.org/Part:BBa_K1150025 BBa_K1150025] (uniCAS Red Light Switch Part I - Stimulator) function as a red light (660nm) inducible histone modification device. It was thought to effectively repress genes of interest by histone methylations after an illumination at 660nm.

It contains the following parts:

Single Parts descriptions

CMV promotor

At first, we tried to use the CMV promotor that was included in the 2012 distribution kit. Part BBa_J52034 was submitted to the registry by Team Slovenia in 2006 and has been on the distribution kit since then (although sequencing was inconsistent every year). After numerous attempts to use this part, we sequenced it and found out that it was not a CMV promotor, but a part of the lacI gene. Reading the part’s review, we noticed that Team Munich 2010 had already pointed out that it was a lacI fragment. Interestingly, Team DTU Denmark was able to induce fluorescent protein expression with this bacterial gene fragment- magic. Since no other mammalian promoter was available on this year’s distribution kit, we designed the following primers and amplified the CMV promoter from the vector pPhi-Yellow-C: GTTACCGGTCTCGTTAAGAATTCGCGGCCGCTTCTAGAGATAGTAATCAATTACGGGGTC CTAGAGGTCTCGCTGCCTGCAGCGGCCGCTACTAGTAGATCTGACGGTTCACTAAAC After incorporation of these primers into the CMV promoter, amplification product, the promoter is not only flanked by the iGEM prefix and suffix, but also by distal BsaI restriction sites. This way, we were able to directly assemble the PCR product.

PhyB

Phytochrome B is a photoreceptor which detects red and far-red light. In Arabidopsis thaliana , Phytochrome B predominantly controls seedling establishment. It is a protein with a molecular mass of 125 kDa that is predominantly located in the cytoplasma. Its structure can be roughly divided in two parts: The N-terminal part, regulatory and photosensory, and the C-terminal part, regulatory. The N-terminal part is covalently bound to phytochromibilin. Phytochromibilin is a linear tetrapyrol that undergoes conformational changes upon radiation of either red- or far red-light when bound to the phytochrome moiety. This conformational change is responsible for the photosensory properties of PhyB. [1] Illumination with red light (660 nm wavelength) leads to binding of Phytochrome Interaction Factor 6 (PIF6). The interaction can be abolished by illumination with far-red light (740 nm) wavelength. Team Freiburg 2013 uses Phy B to induce gene activation or repression via light stimulus. Therefore Phy B can be fused to effector domains like VP16 or KRAB.

AGS linker

Short linker of three amino acids. DNA-Sequence: GCAGGCTCC Aminoacids: AGS

G9A

This part belongs to the uniCAS toolkit of iGEM Team Freiburg 2013 and contains the SET domain of the murine G9a protein. This catalytically active domain is able to transfer methyl groups to lysine 9 of histone 3 (H3K9), which is part of every nucleosome. In regions of open chromatin structures H3K9 methylation can lead to chromatin condensation and thereby inactivation of the concerned locus. This G9a part alone contains the histone methyltransferase domain needed for transcriptional repression and can be combined with dCas9 Part:BBa_K1150000 to target different loci for transcriptional repression of gene expression.

NLS

The nuclear localization signal or nuclear localization sequence (NLS) is a specific amino acid sequence in nuclear proteins. The NLS is recognized by importines, which enable the nuclear proteins the access to the nucleus. It consists mostly of positively charged amino acids like lysine and arginine. In our constructs the NLS found place in many proteins such as Cas9.

BGH terminator

BGH refers to bovine growth hormone terminator that stops transcription of the bgh gene. In our project bgh terminator was cloned succesfully behind many genes of interest.

PhyB - PIF red light switches

One of the best described Phytochromes is Phytochrome B (PhyB). In Arabidopsis thaliana, PhyB predominantly controls seedling establishment. PhyB is a protein with a molecular mass of 125 kDa that is predominantly located in the cytoplasma. Illumination with red light (660nm wavelength) leads to binding of Phytochrome Interaction Factor 6 (PIF6). The interaction can be abolished by illumination with far-red light (740nm) wavelength. A framework using the unique properties of PhyB and PIF6 was designed to enable the recruitment of different effector proteins to any desired gene locus. The system was designed to work as described: Fusion proteins linking Cas9 to PIF6 were designed, as well as fusion proteins linking the interaction partner of PIF6 – PhyB – to several effector molecules such as VP16 or KRAB. PhyB is a protein with a molecular mass of 125k Da that is predominantly located in the cytoplasma. Its structure can be roughly divided in two parts: The N-terminal part, regulatory and photosensory, and the C-terminal part, regulatory. The N-terminal part is covalently bound to phytochromibilin. Phytochromibilin is a linear tetrapyrol that undergoes conformational changes upon radiation of either red- or far red-light when bound to the phytochrome moiety. This conformational change is responsible for the photosensory properties of PhyB (Lars-Oliver Essen, Jo Mailliet, and Jon Hughes 2008; Quail 2002)

Red light inducible histone modification via G9A

For experiments another BioBrick will be needed coding for Cas9-PIF6 (uniCAS Red Light Switch Part I - Stimulator )

The Cas9 protein has built a complex with cr- and tracr RNA, additionaly it is covalently linked to PIF6. After expression, it will bind to its target locus. A red-light stimulus is recruiting the G9A protein linked to PhyB and thereby initiating expression of a target gene. Red light does not carry any pleiotropic or toxic side effects. Red light additionally has no effects on other light-absorbing particles, that may be disrupted by illumination. The Cas9-protein is able to target even multiple gene-loci with only one transfection. Targeting one locus with multiple cr-RNAs may enhance the desired effect; either inhibition or induction of target genes.

Experiments and Results

Method

Cultivation of cell lines

HEK-293T cells were maintained in 100x20 mm cell culture dishes using a CO2-Incubator (37°C, 5% CO2, humidified air). Cells were passaged at 85% confluence. Therefore they were first washed with 5 ml 1x PBS and afterwards detached using 2 ml of Trypsin followed by 10 min of incubation at 37 °C. Subsequently 8 ml of culture medium (DMEM-complete: 10% FCS (1 U/ml); 1% pen/strep (penicillin/streptomycin); 1 l DMEM)was given to the cells. The detached cells were given into fresh culture plates by diluting them 1/10.

Polyethylenimine transfection

Cells were seeded into 24 (0.7*10₅ cells) well culture plates 24 h prior to transfection. For each well 0.75 μg of DNA was given into a OptiMEM - PEI mix (40µl OptiMEM and 1.5µl of PEI (1mg/ml)) and vortexed immediately. The transfection mix was incubated 15 min at RT and subsequently added drop wise to cells. After 12 h of incubation at 37 °C cell culture medium was exchanged.

Phytochromobilin (PCB) treatment

12 h post PEI transfection the cell culture medium was exchanched with fresh medium containing 15µM of PCB. This was performed under green safty light as PCB ist sensitive for red light. After medium exchange the cells were kept in dark.

Light treatment

1h post the addition of PCB cells were illuminated with 2µE of 660nm redlight and for control other cells transfected with the same approach at 740nm with 20µE for 24h.

VEGF ELISA

VEGF ELISA Kits were used from and were performed according to manual.

SEAP meassurement

80 µl of cell supernatant was transferred from a 24-well plate into one 96-well plate (flat bottom), followed by a heat incubation at 65 °C for 30 min. Centrifugation was done for 1 min at 1250 g. 100 µl of SEAP buffer were added to each well. Addition of 20 µl pNPP (substrate) and bubbles carefully removed. Immediately after this, the 96-well plate was placed into a plate reader. Spectroscopic measurement was taken every minute for 120 times (2h) at a wavelenght 405 nm.

Experiment performing

PEI transfection was performed according to protocoll. BBa_K1150028 was transfected togehter with BBa_K1150025 (uniCAS Red Light Switch Part I - Stimulator) and two different crRNAs were used for targeting the VEGF locus ( uniCAS RNaimer to target VEGF2 and uniCAS RNaimer to target VEGF3 ). As off target controle BBa_K1150025 and BBa_K1150028 were transfected without crRNAs and a mock controle was performed by transfecting the full ammount of DNA with pRSetMod (a non coding plasmid backbone).

Results and Discussion

The VEGF values were normalised with the SEAP meassurement to get rid of effects od cell viability. The figure below shows the results for red-light illuminated cells in direct compare to far red illuminated cells. As G9A is thought to repress gene expression of VEGF by histone methylations lower values are expected within the cells illuminated with 660nm light. No effecs can be seen between a red light and far red light illumination of cells. Moreover a general repression effect of G9A in comparison with the non-coding controle cant be seen. It indicates that the hole experiment has yet to be optimised.

Sequence and Features