Difference between revisions of "Part:BBa K1065204:Design"
(→Design Notes) |
|||
Line 8: | Line 8: | ||
===Design Notes=== | ===Design Notes=== | ||
===Design Notes=== | ===Design Notes=== | ||
+ | |||
<html> | <html> | ||
− | The | + | The construct has been builded with a standard assembly. |
+ | We firstly optimized the codons of EFE gene for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br /> | ||
<br /> | <br /> | ||
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/> | <span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/> | ||
Line 15: | Line 17: | ||
...TCG<span style="color:red; font-weight:bold" title="AgeI">ACCGGT</span><b title="Stop">TAA</b><span style="color:blue; font-weight:bold" title="suffix">TACTAGTAGCGGCCGCTGCAG</span> | ...TCG<span style="color:red; font-weight:bold" title="AgeI">ACCGGT</span><b title="Stop">TAA</b><span style="color:blue; font-weight:bold" title="suffix">TACTAGTAGCGGCCGCTGCAG</span> | ||
</html> | </html> | ||
− | |||
− | |||
− | |||
===Source=== | ===Source=== |
Revision as of 09:52, 1 October 2013
Efe+Bba_B0015 in BBa_K823024 (pXyl)
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal prefix found in sequence at 5996
Illegal suffix found in sequence at 1224 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 5996
Illegal SpeI site found at 1225
Illegal PstI site found at 1239
Illegal NotI site found at 1232
Illegal NotI site found at 6002 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 5996
Illegal BglII site found at 319
Illegal BamHI site found at 5980
Illegal XhoI site found at 2234
Illegal XhoI site found at 3152 - 23INCOMPATIBLE WITH RFC[23]Illegal prefix found in sequence at 5996
Illegal suffix found in sequence at 1225 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found in sequence at 5996
Illegal XbaI site found at 6011
Illegal SpeI site found at 1225
Illegal PstI site found at 1239
Illegal NgoMIV site found at 17
Illegal NgoMIV site found at 3116
Illegal NgoMIV site found at 4255
Illegal AgeI site found at 1070 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 4079
Illegal SapI.rc site found at 1828
Design Notes
Design Notes
The construct has been builded with a standard assembly.
We firstly optimized the codons of EFE gene for both B. subtilis and E. coli and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.
GAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCACC...
...TCGACCGGTTAATACTAGTAGCGGCCGCTGCAG
Source
This enzyme was firstly purified from Pseudomonas Siringae pv. phaseolicola PK2, a 2-oxoglutarate-dependent ethylene producing bacterium [1]. The CDS has been optimized for both E.coli and B.subtilis. We decided to include an RBS sequence too.