Difference between revisions of "Part:BBa K818000:Experience"

(→‎User Reviews)
(→‎User Reviews)
Line 101: Line 101:
 
To test for integration, we used the Phenol red Sucrose test; the media where the transformants from the 10ug and 15ug plates were inoculated showed the same results as the control (‘’B. subtilis’’ + pGFPrrnB) with pH ranging between 4.6 – 5.2 suggesting that they could utilized sucrose as their carbon source and produced the acid by products, Figure 3.
 
To test for integration, we used the Phenol red Sucrose test; the media where the transformants from the 10ug and 15ug plates were inoculated showed the same results as the control (‘’B. subtilis’’ + pGFPrrnB) with pH ranging between 4.6 – 5.2 suggesting that they could utilized sucrose as their carbon source and produced the acid by products, Figure 3.
  
−
[[File:BareCillus_Gro_pH.jpg|400px]]
+
[[File:BareCillus_Gro_pH.jpg|900px]]
  
−
Transformants B. subtilis str. 168
 
−
(-ve control) B. subtilis + 30ul of integration plasmid B. subtilis + 45ul of integration plasmid B. subtilis + 60ul of integration plasmid LB + 1% sucrose no inoculants
 
−
(+ve control)
 
−
pH 4.6 4 4.6 5.2 7
 
 
Figure 3. Display the pH of each samples following the Phenol Red Sucrose test on overnight grown culture in LB + 1% Sucrose media.
 
Figure 3. Display the pH of each samples following the Phenol Red Sucrose test on overnight grown culture in LB + 1% Sucrose media.
  
 
We then sequenced the backbone and found out that there were 49 mutations which include SNV, deletions and insertions, Table 1 display the mutations found on the sequence.  
 
We then sequenced the backbone and found out that there were 49 mutations which include SNV, deletions and insertions, Table 1 display the mutations found on the sequence.  
−
Region Type Reference Allele Region Type Reference Allele
 
−
5213 SNV A G 2283 Deletion T -
 
−
2514 SNV C T 661 SNV A A
 
−
3659..3660 Deletion TA - 2320 SNV T T
 
−
3653 Deletion C - 1798 SNV G G
 
−
147..168 Deletion GGTGGGCCTTTCTGCGTTTATA - 2469 Deletion T -
 
−
3685^3686 Insertion - G 114 SNV G A
 
−
294^295 Insertion - AATTCTGCGTGACATCCCAT 794 SNV A A
 
−
5083^5084 Insertion - A 130..152 Deletion GCCTTTCTGCGTTTATAGGTGGG -
 
−
3669 Deletion C - 794 Deletion A -
 
−
3538 Deletion T - 3246 Deletion A -
 
−
1784 Deletion T - 2320 Deletion T -
 
−
5119 Deletion T - 114 SNV G G
 
−
780 SNV T T 2469 SNV T T
 
−
475 Deletion A - 1798 Deletion G -
 
−
2693 SNV G G 661 Deletion A -
 
−
3485 SNV A A 2283 SNV T T
 
−
1371 SNV C C 2957 Deletion A -
 
−
1372 SNV T T 1327 SNV A A
 
−
2957 SNV A A 3485 Deletion A -
 
−
1327 Deletion A - 3626 Deletion A -
 
−
3626 SNV A A 780 Deletion T -
 
−
4045 SNV C C 2693 Deletion G -
 
−
1377 Deletion T - 4045 Deletion C -
 
−
1371..1372 Deletion CT - 2382 Deletion T -
 
  
−
Table 1. Shows all the mutations found in the BBa_K818000 backbone.
 
−
 
−
To double check the results of the sequencing, we designed two sets of primers and amplified the region where mutations were high, Table 2 displays the results of the sequencing and the mutations found.
 
−
Position Region Type Reference Allele
 
−
5213 Prefix SNV A G
 
−
2514 un-specified SNV C T
 
−
3659..3660 sacA region Deletion TA -
 
−
3653 sacA region Deletion C -
 
−
147..168 Double Terminator Deletion GGTGGGCCTTTCTGCGTTTATA -
 
−
3685^3686 sacA region Insertion - G
 
−
294^295 sacA region Insertion - AATTCTGCGTGACATCCCAT
 
−
5083^5084 un-specified Insertion - A
 
−
3669 sacA region Deletion C -
 
−
3538 sacA region Deletion T -
 
  
 
Table 2. Shows list of mutations found in the BBa_K818000 backbone, including the position, region and type of mutations after analysing the initial sequencing and the sequencing of highly mutated regions.
 
Table 2. Shows list of mutations found in the BBa_K818000 backbone, including the position, region and type of mutations after analysing the initial sequencing and the sequencing of highly mutated regions.

Revision as of 16:55, 30 September 2013

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K818000

This backbone plasmid was used as primary backbone for all constructs in team Groningen 2012 project: the Food Warden. For further info: [http://2012.igem.org/Team:Groningen/OurBiobrick iGEM Groningen 2012 biobrick page]

User Reviews

UNIQb3939504768dd5c5-partinfo-00000000-QINU

No part name specified with partinfo tag. Newcastle University iGEM 2013

This BioBrick was designed to be used as an integration backbone for the ‘’B. subtilis’’ by integrating at the ‘’sacA’’ region of the endogenous chromosome via double crossover. The Groningen iGEM 2012 team has showed that this BioBrick can be replicated in ‘’E. coli’’, however have not showed any results/characterisation that this backbone can integrate correctly in ‘’B. subtilis’’.

We transformed this backbone into ‘’B. subtilis’’ but as can be seen in Figure 1, no colonies were found on the ‘’B. subtilis’’ str. 168 + pSac-Cm derived integration plasmid, however the positive control ‘’B. subtilis’’ str.168 + pGFPrrnB (integrates at amyE) did work, which suggested that this backbone was not integrated.


Pulpit rock
Plate 1: B. Subtilis str. 168 transformed with switch BioBrick.
 Pulpit rock
Plate 2: B.subtilis str. 168 transformed with pGFPrrnB (positive control).
Pulpit rock
Plate 3: B. subtilis str. 168 no transformation (negative control).
Figure 1. Plates of B. Subtilis str. 168 transformed with switch BioBrick, pGFPrrnB (positive control) and water (negative control).

We repeated the transformations using higher concentration of plasmids 5ug, 10ug, and 15ug and plated them onto the LB + 5ug/ml Chloramphenicol plates. The results Figure 2, shows that there were colonies growing on the 10ug and 15ug plates.

Pulpit rock
10 minutes
 Pulpit rock
30 minutes
Pulpit rock
60 minutes
 Pulpit rock
120 minutes
Pulpit rock
240 minutes
Figure 4. Negative control: Fluorescence microscopy showing how sfGFP expession changes with time on addition of 0mM IPTG in B.subtilis containing our HBsu-sfGFP BioBrick.

To test for integration, we used the Phenol red Sucrose test; the media where the transformants from the 10ug and 15ug plates were inoculated showed the same results as the control (‘’B. subtilis’’ + pGFPrrnB) with pH ranging between 4.6 – 5.2 suggesting that they could utilized sucrose as their carbon source and produced the acid by products, Figure 3.

BareCillus Gro pH.jpg

Figure 3. Display the pH of each samples following the Phenol Red Sucrose test on overnight grown culture in LB + 1% Sucrose media.

We then sequenced the backbone and found out that there were 49 mutations which include SNV, deletions and insertions, Table 1 display the mutations found on the sequence.


Table 2. Shows list of mutations found in the BBa_K818000 backbone, including the position, region and type of mutations after analysing the initial sequencing and the sequencing of highly mutated regions.

The results from both sequencing run proved to show similar mutations were found on this backbone, most of the mutations occurred in the sacA integration regions. These results explained the reason why this pSac-Cm derived integration backbone for ‘’B.subtilis’’ were not working.

To get round this problem, we align the sequence of this BioBrick to the Integration vector pSac-Cm sequence from the (Middleton, R., Hofmeister, A. New shuttle vectors for ectopic insertion of genes into Bacillus subtilis. Plasmid Volume 51, Issue 3, May 2004, Pages 238–245). The results showed that the sequence that the Groningen team 2012 put up on the registry was correct. This suggests that the plasmid that they have submitted and the sequence they provided did not match. By using the correct sequence to generate this integration plasmid we will be able to make this part functional not just in ‘’E. coli’’ but also ‘’B. subtilis.


;