Difference between revisions of "Part:BBa K818000:Experience"

(→‎Applications of BBa_K818000)
Line 15: Line 15:
 
<I>Username</I>
 
<I>Username</I>
 
|width='60%' valign='top'|
 
|width='60%' valign='top'|
−
Enter the review inofrmation here.
+
At the start of our project, we were looking for ‘’Bacillus subtilis’’ integration plasmid that we could use to clone our BioBricks into. We came across the BBa_K818000 which is an integration vector designed by the 2012 Groningen iGEM team for ‘’B. subtilis’’ derived from pSac-Cm by insertion of the BioBrick compatible restriction sites (prefixes and suffixes), a terminator (BBa_B0015) after the suffixes sequences and the sequence for a red fluorescent protein (RFP) in its Multiple cloning sites (MCS). This plasmid contains the ‘’bla’’ gene (which gives ampicilin resistance to transform ‘’Escherichia coli’’) and ‘’cm’’ gene (conferring resistance to chloramphenicol, in ‘’B. subtilis’’). As can be seen in Figure 1, this backbone was designed to integrate at ‘’sacA’’ via double crossover. So, if this plasmid backbone is successfully integrates into ‘’B. subtilis’’ chromosome, transformants would not be able to metabolize sucrose.
 +
 
 +
Even though, there are no results showing that this backbone works as expected in ‘’B. subtilis’’, we requested this plasmid directly from the 2012 Groningen team. Prior to using it to clone our BioBrick in, we characterised this part by transforming it into ‘’E. coli’’.  We used 2ug of this backbone to transform competent ‘’E. coli’’, 2ug of pGFPrrnB plasmid as positive control, and H2O as negative control. Figure 2, shows that the transformed ‘’E. coli’’ with BBa_K818000 expressed the RFP protein, suggesting that this backbone is fully functional in ‘’E. coli’’.
 +
To further characterize this backbone, we purified the plasmid from the transformed ‘’E. coli’’ and transformed 5ug into competent ‘’B. subtilis’’; however as can be seen in Figure 3, no colonies were found on the ‘’B. subtilis’’ str. 168 + pSac-Cm derived integration plasmid, and negative control (+H20) plates.  However the positive control ‘’B. subtilis’’ str.168 + pGFPrrnB (integrates at amyE) did work.
 +
 
 +
We also performed iodine test to be sure that the colonies on positive control were indeed colonies that have integrated the plasmid at amyE. Figure 4, confirmed this results showing no zone of clearance was found around the colonies.
 +
 
 +
 
 +
Before taking the conclusion that this integration plasmid did not work as designed, we performed a series of ‘’B. subtilis’’ transformations with the pSac-Cm derived integration plasmid, ranging the concentration of plasmid that we used from 10 to 60 ul, and the concentration of Chloramphenicol used from 5ug/ml to 12.5ug/ml. Table 1, summarises the results of the transformation into a table, the results of this transformation looks promising.
 +
 
 +
Agar/Transformants pGFPrrnB (positive control) Groningen plasmid 30 µl Groningen plasmid 45 µl Groningen plasmid 60 µl Water
 +
Nutrient Agar + 5µg/ml Cm 134 Colonies 9 Colonies 12 Colonies 7 Colonies 0 Colonies
 +
LB Agar = 12.5µg/ml Cm 142 Colonies 1 Colonies 2 Colonies 3 Colonies 0 Colonies
 +
 
 +
Table 1. Summarise the number of colonies found on each of the transformation plates.
 +
 +
Still, in order to confirm that the transformants on each plate were indeed colonies contained the pSac-Cm derived plasmid integrated in their chromosome we needed to perform the Phenol Red Sucrose test. We inoculate them onto nutrient broth to which 1.0% sucrose is added and incubate at 37oC overnight. If sucrose can be used, the microbe will accumulate acidic by products, thus changing the pH of the medium from its neutral pH color (red) into yellow (< 6.8 pH).
 +
 
 +
Table 2, summarised the results of the test. The negative control which is ‘’B. subtilis’’ str. 168 wild type and ‘’B.subtilis’’ with pGFPrrnB both have pH 4.6 and 5 respectively suggest they digest sucrose (expected), the positive control media without any inoculants stay pH 7. However for all of the media with ‘’B. subtilis’’ + the integration plasmid instead of staying as pH 7, all three showed pH of 4, 4.6, and 5.2 which suggested that they can utilize sucrose as carbon and energy source thus this integration plasmid is not integrated as design into ‘’sacA’’.
 +
Transformants B. subtilis str. 168
 +
(-ve control) B. subtilis + pGFPrrnB
 +
(-ve control) B. subtilis + 30ul of integration plasmid B. subtilis + 45ul of integration plasmid B. subtilis + 60ul of integration plasmid LB + 1% sucrose no inoculants
 +
(+ve control)
 +
pH 4.6 5 4 4.6 5.2 7
 +
 
 +
Table 2. Display the pH of each samples following the Phenol Red Sucrose test on overnight grown culture in LB + 1% Sucrose media.
 +
 
 +
 
 +
 
 +
We decided to sequence the pSac-Cm derived integration plasmid and discovered that there were 49 mutations (inc. SNV, insertions, and deletions) throughout the plasmid, Figure 5. Some of the mutations have a very low frequency below 75% and we decided to filter them out after comparing the consensus and the reads. Even after filtering out some mutations, there were still major changes, which includes 22bp deletions around 130-168bp and a 21bp insertion at 294bp, these regions are in the ‘’sacA’’ homology region.
 +
 
 +
Region Type Reference Allele Region Type Reference Allele
 +
5213 SNV A G 2283 Deletion T -
 +
2514 SNV C T 661 SNV A A
 +
3659..3660 Deletion TA - 2320 SNV T T
 +
3653 Deletion C - 1798 SNV G G
 +
147..168 Deletion GGTGGGCCTTTCTGCGTTTATA - 2469 Deletion T -
 +
3685^3686 Insertion - G 114 SNV G A
 +
294^295 Insertion - AATTCTGCGTGACATCCCAT 794 SNV A A
 +
5083^5084 Insertion - A 130..152 Deletion GCCTTTCTGCGTTTATAGGTGGG -
 +
3669 Deletion C - 794 Deletion A -
 +
3538 Deletion T - 3246 Deletion A -
 +
1784 Deletion T - 2320 Deletion T -
 +
5119 Deletion T - 114 SNV G G
 +
780 SNV T T 2469 SNV T T
 +
475 Deletion A - 1798 Deletion G -
 +
2693 SNV G G 661 Deletion A -
 +
3485 SNV A A 2283 SNV T T
 +
1371 SNV C C 2957 Deletion A -
 +
1372 SNV T T 1327 SNV A A
 +
2957 SNV A A 3485 Deletion A -
 +
1327 Deletion A - 3626 Deletion A -
 +
3626 SNV A A 780 Deletion T -
 +
4045 SNV C C 2693 Deletion G -
 +
1377 Deletion T - 4045 Deletion C -
 +
1371..1372 Deletion CT - 2382 Deletion T -
 +
 
 +
Figure 5. Shows all the mutations found in the BBa_K818000 backbone.
 +
 
 +
 
 +
 
 +
To ensure that the sequencing was correct, we designed 2 set of primers to amplify the region where the mutations accumulated. First set of primer amplify region from 5083bp up to 295bp, and second set of primer amplify region around 2514bp up to 3685bp we then sent it for sequencing. The results of the sequencing and analysis summarize in Figure 6.
 +
Position Region Type Reference Allele
 +
5213 Prefix SNV A G
 +
2514 un-specified SNV C T
 +
3659..3660 sacA region Deletion TA -
 +
3653 sacA region Deletion C -
 +
147..168 Double Terminator Deletion GGTGGGCCTTTCTGCGTTTATA -
 +
3685^3686 sacA region Insertion - G
 +
294^295 sacA region Insertion - AATTCTGCGTGACATCCCAT
 +
5083^5084 un-specified Insertion - A
 +
3669 sacA region Deletion C -
 +
3538 sacA region Deletion T -
 +
 +
Figure 6. Shows list of mutations found in the BBa_K818000 backbone, including the position, region and type of mutations after analysing the initial sequencing and the sequencing of highly mutated regions.
 +
 
 +
We conclude that all the mutations listed in figure 6 affects the integration of this plasmid to the ‘’sacA’’ region of ‘’B.subtilis’’.
 +
 
 
|};
 
|};
 
<!-- End of the user review template -->
 
<!-- End of the user review template -->
 
<!-- DON'T DELETE --><partinfo>BBa_K818000 EndReviews</partinfo>
 
<!-- DON'T DELETE --><partinfo>BBa_K818000 EndReviews</partinfo>

Revision as of 12:54, 30 September 2013

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K818000

This backbone plasmid was used as primary backbone for all constructs in team Groningen 2012 project: the Food Warden. For further info: [http://2012.igem.org/Team:Groningen/OurBiobrick iGEM Groningen 2012 biobrick page]

User Reviews

UNIQf1790e392a403f1d-partinfo-00000000-QINU UNIQf1790e392a403f1d-partinfo-00000001-QINU