Revision as of 14:24, 27 July 2006

Recombinational Enhancer (RE) for Hin/Hix inverting

Design Notes

The base pair change of a T from a C occurred during cloning but is located in the spacer region between the fis binding sites; therefore, we believe that it will still work.

The insertion is right before the biobrick ends and several bases after the distal fis binding site; therefore, we believe it will function correctly.

We chose this RE to use because after cloning it retained functional full biobricks and the mutations do not seem harmful to function. The other RE that were cloned retained the proper RE sequence but lost critical cut sites in the biobricks.

RE is cloned in plasmid pSB1A2.

BioBricks

The BioBricks designed for this part are not wild type, but the cut sites are still viable. The following is the sequence with its BioBricks: GAATTCGCGGCCGCTTCTAGA-TTCGGGTGTCAACAATTGACCAAAATATTGATTTACAGCGTAATGCGCTTTCTAGTGCAAATTGTGACCGCATTTTGACTAGTTGCGGCCGCCTGCAG

There is no G spacer between the XbaI and the insert.

The spacer between the insert and the SpeI site is a G instead of a T.

The spacer between the SpeI site and the NotI site is a T instead of an A.

The last C of the NotI site is not conserved with the initial C from the PstI site.

The BB suffix currently has this sequence for Not I and PstI: GCGGCCGcCTGCAG

But it should have been: GCGGCCGCTGCAG

We compared our BioBricks with those from Tom Knight's paper, Idempotent Vector Design for Standard Assembly of Biobricks. As seen below

Source

References

Haykinson and Johnson. 1993. DNA looping and the helical repeat in vitro and in vivo: effect of HU protein and enhancer location on Hin invertasome assembly [http://www.pubmedcentral.gov/articlerender.fcgi?tool=pubmed&pubmedid=8508775]

PERKINS-BALDING D, DIAS D, and GLASGOW A:Location, Degree, and Direction of DNA Bending Associated with the Hin Recombinational Enhancer Sequence and Fis-Enhancer Complex

Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks