Difference between revisions of "Part:BBa K1104100:Design"
JosephHuang (Talk | contribs) (→Mannosidase function test) |
JosephHuang (Talk | contribs) (→Mannosidase function test) |
||
| Line 28: | Line 28: | ||
==Mannosidase function test== | ==Mannosidase function test== | ||
After cloning mngB gene into ''E. coli'', it is a must to know whether our part is well-constructed and well perform. Therefore, we decide to extract alpha-mannosidase from the cytoplasm of ''E. coli'', and test its function by directly interact with 2-O-(6-phospho-α-D-mannosyl)-D-glycerate. With the aid of HPLC, we can evidently realize whether our part is able to turn it into α-D-mannose-6-phosphate and D-glycerate. | After cloning mngB gene into ''E. coli'', it is a must to know whether our part is well-constructed and well perform. Therefore, we decide to extract alpha-mannosidase from the cytoplasm of ''E. coli'', and test its function by directly interact with 2-O-(6-phospho-α-D-mannosyl)-D-glycerate. With the aid of HPLC, we can evidently realize whether our part is able to turn it into α-D-mannose-6-phosphate and D-glycerate. | ||
| − | + | ||
| + | Experimental process is listed below: | ||
1.Use Continuous High Pressure Cell Disrupter to crush the ''E. coli'' that produce alpha-mannosidase <br> | 1.Use Continuous High Pressure Cell Disrupter to crush the ''E. coli'' that produce alpha-mannosidase <br> | ||
2.Filter the product and save the filtrate in a eppendorf<br> | 2.Filter the product and save the filtrate in a eppendorf<br> | ||
Revision as of 17:38, 27 September 2013
mngB - alpha-mannosidase
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 716
Illegal BglII site found at 992
Illegal BglII site found at 2139 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 235
Illegal AgeI site found at 2242 - 1000COMPATIBLE WITH RFC[1000]
Design
alpha mannosidase primer:
Since the mngB comes directly from E. coli substrain MG1655, we have designed a primer to clone from the whole genome of MG1655. The primer we use is listed below:
| primer sequence | whole primer temp. | binding part temp. | GC% | |
|---|---|---|---|---|
| forward: | ctg GAATTCGCGGCCGCTTCTAG atgAAAGCAGTATCTCGCGTTCACATCACCCCG | 76℃ | 68℃ | 55% |
| reverse: | gga CTGCAGCGGCCGCTACTAGTA tcaGGCAAGCCGGTAACTGAACGTCCG | 76℃ | 68℃ | 58% |
Mannosidase function test
After cloning mngB gene into E. coli, it is a must to know whether our part is well-constructed and well perform. Therefore, we decide to extract alpha-mannosidase from the cytoplasm of E. coli, and test its function by directly interact with 2-O-(6-phospho-α-D-mannosyl)-D-glycerate. With the aid of HPLC, we can evidently realize whether our part is able to turn it into α-D-mannose-6-phosphate and D-glycerate.
Experimental process is listed below:
1.Use Continuous High Pressure Cell Disrupter to crush the E. coli that produce alpha-mannosidase
2.Filter the product and save the filtrate in a eppendorf
3.Add 2-O-(6-phospho-α-D-mannosyl)-D-glycerate into an eppendorf
4.Incubate at 25℃ for 30 min.
5.Run HPLC and compare it with the two standard line of only 2-O-(6-phospho-α-D-mannosyl)-D-glycerate and with only the extraction liquid of E. coli cytoplasm
6.Compare the area of the data lines with the area of the standard line to calculate the efficiency of the alpha-mannosidase produced by E. coli
Source
E. coli, K12, MG1655