Difference between revisions of "Part:BBa K1104100:Experience"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
 
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
Line 5: Line 4:
  
 
===Applications of BBa_K1104100===
 
===Applications of BBa_K1104100===
 +
==Experiment==
 +
 +
'''alpha mannosidase primer:'''<br>
 +
　　Since the mngB comes direct from ''E. coli'' substrain MG1655, we have designed a primer to clone from the whole genome of MG1655.The primer we used is listed below:
 +
<br>
 +
{|class="wikitable"
 +
|-
 +
!
 +
!primer sequence
 +
!whole primer temp.
 +
!binding part temp.
 +
!GC%
 +
|-
 +
|forward:
 +
| ctg GAATTCGCGGCCGCTTCTAG atgAAAGCAGTATCTCGCGTTCACATCACCCCG
 +
|76℃
 +
|68℃ ||55%
 +
|-
 +
|reverse: || gga CTGCAGCGGCCGCTACTAGTA tcaGGCAAGCCGGTAACTGAACGTCCG ||76℃ ||68℃ ||58%
 +
|}
 +
 +
'''mannosidase function test'''<br>
 +
　　After cloning the mngB gene into the ''E. coli'', we would want to know whether our part work. So we decided to extract alpha-mannosidase from the cytoplasm of the ''E. coli'' and test its function by directly interact with 2-O-(6-phospho-α-D-mannosyl)-D-glycerate, and through HPLC to see if it can successfully turn it into α-D-mannose-6-phosphate and D-glycerate.Experimental process is listed below:
 +
<br>
 +
1.use Continuous High Pressure Cell Disrupter to crush the ''E. coli'' that produce alpha-mannosidase <br>
 +
2.filter the product and save the filtrate in a eppendorf<br>
 +
3.add 2-O-(6-phospho-α-D-mannosyl)-D-glycerate into eppendorf <br>
 +
4.incubate at 25℃ for 30 min.<br>
 +
5.run HPLC and compare it with the two standard line of only 2-O-(6-phospho-α-D-mannosyl)-D-glycerate and with only the extraction liquid of ''E. coli'' cytoplasm <br>
 +
6.compare the area of the data lines with the area of the standard line to calculate the efficiency of the alpha-mannosidase produced by ''E. coli''
  
 
===User Reviews===
 
===User Reviews===

Revision as of 17:23, 27 September 2013

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1104100

Experiment

alpha mannosidase primer:
　　Since the mngB comes direct from E. coli substrain MG1655, we have designed a primer to clone from the whole genome of MG1655.The primer we used is listed below:

primer sequence whole primer temp. binding part temp. GC%
forward: ctg GAATTCGCGGCCGCTTCTAG atgAAAGCAGTATCTCGCGTTCACATCACCCCG 76℃ 68℃ 55%
reverse: gga CTGCAGCGGCCGCTACTAGTA tcaGGCAAGCCGGTAACTGAACGTCCG 76℃ 68℃ 58%

mannosidase function test
　　After cloning the mngB gene into the E. coli, we would want to know whether our part work. So we decided to extract alpha-mannosidase from the cytoplasm of the E. coli and test its function by directly interact with 2-O-(6-phospho-α-D-mannosyl)-D-glycerate, and through HPLC to see if it can successfully turn it into α-D-mannose-6-phosphate and D-glycerate.Experimental process is listed below:
1.use Continuous High Pressure Cell Disrupter to crush the E. coli that produce alpha-mannosidase
2.filter the product and save the filtrate in a eppendorf
3.add 2-O-(6-phospho-α-D-mannosyl)-D-glycerate into eppendorf
4.incubate at 25℃ for 30 min.
5.run HPLC and compare it with the two standard line of only 2-O-(6-phospho-α-D-mannosyl)-D-glycerate and with only the extraction liquid of E. coli cytoplasm
6.compare the area of the data lines with the area of the standard line to calculate the efficiency of the alpha-mannosidase produced by E. coli

User Reviews

UNIQb52ff13dd6f2f1e2-partinfo-00000000-QINU UNIQb52ff13dd6f2f1e2-partinfo-00000001-QINU