Difference between revisions of "Help:BioBrick Prefix and Suffix"

m (use span instead of div for inline styles)
Line 20: Line 20:
 
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:
 
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:
 
|width='50%' valign='top'|
 
|width='50%' valign='top'|
<div style='font-family:monospace;font-size:175%;padding-left:1em;'>gaattcgcggccgcttctag</div>
+
<span style='font-family:monospace;font-size:175%;padding-left:1em;'>gaattcgcggccgcttctag</span>
 
|-
 
|-
 
|width='50%'|
 
|width='50%'|
 
Otherwise, the BioBrick prefix is:
 
Otherwise, the BioBrick prefix is:
 
|width='50%'|
 
|width='50%'|
<div style='font-family:monospace;font-size:175%;padding-left:1em'>gaattcgcggccgcttctagag</div>
+
<span style='font-family:monospace;font-size:175%;padding-left:1em'>gaattcgcggccgcttctagag</span>
 
|}
 
|}
  
Line 34: Line 34:
 
The standard BioBrick suffix is always:
 
The standard BioBrick suffix is always:
 
|width='50% 'valign='top'|
 
|width='50% 'valign='top'|
<div style='font-family:monospace;font-size:175%;padding-left:1em'>tactagtagcggccgctgcag</div>
+
<span style='font-family:monospace;font-size:175%;padding-left:1em'>tactagtagcggccgctgcag</span>
 
|}
 
|}
  
Line 45: Line 45:
 
If the second part starts "AT", the scar is:
 
If the second part starts "AT", the scar is:
 
|width='50%' valign='top'|
 
|width='50%' valign='top'|
<div style='font-family:monospace;font-size:175%;padding-left:1em;'>tactag</div>
+
<span style='font-family:monospace;font-size:175%;padding-left:1em;'>tactag</span>
 
|-
 
|-
 
|width='50%'|
 
|width='50%'|
 
Otherwise, the scar is:
 
Otherwise, the scar is:
 
|width='50%'|
 
|width='50%'|
<div style='font-family:monospace;font-size:175%;padding-left:1em'>tactagag</div>
+
<span style='font-family:monospace;font-size:175%;padding-left:1em'>tactagag</span>
 
|}
 
|}
  

Revision as of 17:54, 23 July 2006

Partinps.png

For more information about how the prefix and suffix were determined and the special case of coding regions, see Assembly:RBS-CDS_issues.

Part Sequence

The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include any bases of the BioBrick Prefix or Suffix.

Plasmids (see below) and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.


BioBrick Prefix

The standard BioBrick prefix depends on the part that follows it.

If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:

gaattcgcggccgcttctag

Otherwise, the BioBrick prefix is:

gaattcgcggccgcttctagag


BioBrick Suffix

The standard BioBrick suffix is always:

tactagtagcggccgctgcag


BioBrick Scar

When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts.

If the second part starts "AT", the scar is:

tactag

Otherwise, the scar is:

tactagag


Plasmid Sequences

Since plasmids are circular pieces of DNA, the specification of the "first" base is arbitrary. Furthermore, plasmids often hold BioBrick parts, leading to a question of how the plasmid itself is defined.

In the Registry, we define the plasmid as starting with the first base of the suffix and ending with the last base of the BioBrick prefix. That definition keeps the plasmid continuous and breaks it where parts will be inserted.