Difference between revisions of "Help:Terminators"

Revision as of 18:03, 17 July 2006

Browse terminator parts!

A terminator (short for "transcriptional terminator") is a stretch of DNA which halts the process of transcription (making RNA to protein).

Stem-loop type terminators

An example of a stem-loop coding region (location indicated by the hairpin picture) in Part:BBa_B0011

In our prokaryotic biobricks, host cells, these terminator parts are often palindromic (same sequence backwards and forwards) and form a stem-loop structure by folding back on itself and terminates transcription in this way.
One example of a biobrick which uses this method is the terminator Part:BBa_B0011, which has the palindromic sequence "aaaagccagattattaatccggctttt"

Poly-A tails

In eukaryotic hosts such as yeast, a string of adenosine ("A") nucleotides is the primary method through which termination of transcription occurs. This is mediated by exonucleases (enzymes which cut at this recognition sequence). A popular "poly-A" motif is "AAUAAA".

Rho type terminators

Another method which cells use to terminate a sequence is through the action of the Rho protein.