Difference between revisions of "Part:BBa K823039"

Revision as of 20:23, 14 September 2013 (view source) Earthnut (Talk | contribs) ← Older edit		Revision as of 20:30, 14 September 2013 (view source) Earthnut (Talk | contribs) Newer edit →
Line 2:		Line 2:
	<partinfo>BBa_K823039 short</partinfo>		<partinfo>BBa_K823039 short</partinfo>
	[[File:TUM13 Animation_GFP.gif|thumb|right|320px| Figure: Animated structure of the green fluorescent protein (GFP) based on the cristall structure [http://www.rcsb.org/pdb/explore.do?structureId=2WUR 2WUR]		[[File:TUM13 Animation_GFP.gif|thumb|right|320px| Figure: Animated structure of the green fluorescent protein (GFP) based on the cristall structure [http://www.rcsb.org/pdb/explore.do?structureId=2WUR 2WUR]
−	with an identitiy of 98% with this BioBrick. Added by TUM 2013 Team ]]	+	with an identitiy of 98% with this BioBrick. Added by [http://2013.igem.org/Team:TU-Munich TUM 2013 Team]. ]]
	This gfpmut3 gene was amplified from pGFPamy B. subtilis vector.		This gfpmut3 gene was amplified from pGFPamy B. subtilis vector.

---

Revision as of 20:30, 14 September 2013

gfpmut1 (B. subtilis optimized + Freiburg standard)

This gfpmut3 gene was amplified from pGFPamy B. subtilis vector.

It is constructed in the Freiburg standard with RBS.

Find out more about the design of our prefix with ribosome binding site.

prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

We took a gfp derivate of the Bacillus subtilis plasmids pGFPamy and added the BioBrick compatiple pre- and suffix of the Freiburg standard (Assembly 25). This BioBrick was used to create our [http://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins Sporobeads]. It is part of the BioBrick K823049

Find out more about our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks Bacillus BioBrick Box] and the created [http://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins Sporobeads].

Sequence and Features