Difference between revisions of "Help:Terminators"

Revision as of 14:20, 29 June 2006

A terminator (short for "transcriptional terminator") is a stretch of DNA which halts the process of transcription (making RNA to protein). Its sequence indicates the end of a functional operon (ie. a coding region attached to a regulatory region)

Stem-loop type terminators

An example of a stem-loop coding region (location indicated by the hairpin picture) in Part:BBa_B0011

In our prokaryotic biobricks, host cells, these terminator parts are often palindromic (same sequence backwards and forwards) and form a stem-loop structure by folding back on itself and terminates transcription in this way.
One example of a biobrick which uses this method is the terminator Part:BBa_B0011, which has the palindromic sequence "aaaagccagattattaatccggctttt"

Poly-A tails

In eukaryotic hosts such as yeast, a string of adenosine ("A") nucleotides is the primary method through which termination of transcription occurs. This is mediated by exonucleases (enzymes which cut at this recognition sequence). A popular "poly-A" motif is "AAUAAA".

Rho type terminators

Another method which cells use to terminate a sequence is through the action of the Rho protein.

@@ Line 7: / Line 7: @@
 ==Stem-loop type terminators==
+[[Image:B0011 - stem loop terminator.png|thumb|An example of a stem-loop coding region (location indicated by the hairpin picture) in [[Part:BBa_B0011]]]]
 In our prokaryotic biobricks, [https://parts.igem.org/cgi/partsdb/pgroup.cgi?pgroup=cell host cells], these [https://parts.igem.org/cgi/partsdb/pgroup.cgi?pgroup=terminator terminator parts] are often palindromic (same sequence backwards and forwards) and form a stem-loop structure by folding back on itself and terminates transcription in this way.<br>
 One example of a biobrick which uses this method is the terminator [[Part:BBa_B0011]], which has the palindromic sequence "<font color = "green">aaaagccagattat</font><font color = "red">taatccggctttt</font>"