Difference between revisions of "Help:Terminators"
Smelissali (Talk | contribs) |
Smelissali (Talk | contribs) |
||
| Line 4: | Line 4: | ||
<hr> | <hr> | ||
| − | A terminator is a | + | A terminator is a stretch of DNA which halts the process of transcription (making RNA to protein). Its sequence indicates the end of a functional operon (ie. a [[Help:Protein coding|coding region]] attached to a regulatory region) |
| + | |||
| + | ==Stem-loop type terminators== | ||
| + | In our prokaryotic biobricks, [https://parts.igem.org/cgi/partsdb/pgroup.cgi?pgroup=cell host cells], these [https://parts.igem.org/cgi/partsdb/pgroup.cgi?pgroup=terminator terminator parts] are often palindromic (same sequence backwards and forwards) and form a stem-loop structure by folding back on itself and terminates transcription in this way.<br> | ||
| + | One example of a biobrick which uses this method is the terminator [[Part:BBa_B0011]], which has the palindromic sequence "<font color = "green">aaaagccagattat</font><font color = "red">taatccggctttt</font>" | ||
| + | |||
| + | |||
| + | ==Rho type terminators== | ||
| + | Another method which cells use to terminate a sequence is through the action of the Rho protein. | ||
Revision as of 13:55, 29 June 2006
Browse terminator parts!
A terminator is a stretch of DNA which halts the process of transcription (making RNA to protein). Its sequence indicates the end of a functional operon (ie. a coding region attached to a regulatory region)
Stem-loop type terminators
In our prokaryotic biobricks, host cells, these terminator parts are often palindromic (same sequence backwards and forwards) and form a stem-loop structure by folding back on itself and terminates transcription in this way.
One example of a biobrick which uses this method is the terminator Part:BBa_B0011, which has the palindromic sequence "aaaagccagattattaatccggctttt"
Rho type terminators
Another method which cells use to terminate a sequence is through the action of the Rho protein.