Difference between revisions of "Part:BBa J45003:Design"
(→Primers) |
|||
| Line 1: | Line 1: | ||
==Primers== | ==Primers== | ||
Forward primer: 5'- <b>atg gag gta atg cga gtt ctt c</b> -3' | Forward primer: 5'- <b>atg gag gta atg cga gtt ctt c</b> -3' | ||
| + | Reverse primer: 5'- <b>accggttctaacgagcgaaag</b> -3' | ||
==Design Consideration== | ==Design Consideration== | ||
Revision as of 16:20, 26 June 2006
Primers
Forward primer: 5'- atg gag gta atg cga gtt ctt c -3' Reverse primer: 5'- accggttctaacgagcgaaag -3'
Design Consideration
This part would be used to make a jasmine scent.
Source
If we find a source, it will probably be donated by Seo et al. GENBANK Accession Number = BD441046
References
Seo HS, Song JT, Cheong JJ, Lee YH, Lee YW, Hwang I, Lee JS, and Choi YD. Jasmonic acid carboxyl methyltransferase: a key enzyme for jasmonate-regulated plant responses. Proc Natl Acad Sci U S A 2001 Apr 10; 98(8) 4788-93. doi:10.1073/pnas.081557298 pmid:11287667. PubMed HubMed [Seo01]