Difference between revisions of "Part:BBa K1065000:Design"
(→Source) |
(→Design Notes) |
||
Line 9: | Line 9: | ||
<html> | <html> | ||
− | + | The coding sequence was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br /> | |
<br /> | <br /> | ||
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/> | <span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/> |
Revision as of 09:18, 25 June 2013
2-oxoglutarate oxygenase/decarboxylase (EFE)
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 319
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 17
Illegal AgeI site found at 1070 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
The coding sequence was taken from Pseudomonas syringae pv. phaseolicola PK2. We firstly optimized the codons for both B. subtilis and E. coli and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.
GAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCACC...
...TCGACCGGTTAATACTAGTAGCGGCCGCTGCAG
Source
Synthesized by GenScript®.
References
- Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from Pseudomonas syringae pv. phaseolicola PK2. Journal of General Microbiology 137: 2281–2286.
- Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of Pseudomonas syringae pv. phaseolicola PK2. Biochem Biophys Res Commun 188: 826–832.
- Fernando Guerrero, Vero´ nica Carbonell., Matteo Cossu., Danilo Correddu, Patrik R. Jones (2012) Ethylene Synthesis and Regulated Expression of Recombinant Protein in Synechocystis sp. PCC 6803. PLoS ONE 7(11): e50470.