Difference between revisions of "Part:BBa K883705"
Line 18: Line 18:
 
[[Image:Gfpcoilhistag.PNG|300px|center|thumb|<p align="justify">''Figure 4: protein folding prediction of GFP (green) with a His-tag (blue) fused to a coiled coil (purple)]]
 
[[Image:Gfpcoilhistag.PNG|300px|center|thumb|<p align="justify">''Figure 4: protein folding prediction of GFP (green) with a His-tag (blue) fused to a coiled coil (purple)]]
  
 +
To be able to use the device, the counterpart of the E-coil needs to be fused to the protein that needs to be detected.
 +
 +
 +
{| class="wikitable" style="text-align: center"
 +
|- style="font-style: italic"
 +
|name
 +
|sequence 
 +
|translated 
 +
|-
 +
|K-coil (counterpart)
 +
|aagatagcggcgttgaaggagaaaatcgcagcactaaaagaaaagatagcggcgttgaaggag   
 +
|KIAALKEKIAALKEKIAALKE     
 +
|-
 +
|E-coil (present in the brick)   
 +
|gaaattgcggcgctggaaaaagaaattgcggcgctggaaaaagaaattgcggcgctggaaaaa     
 +
|EIAALEKEIAALEKEIAALEK     
 +
|}
 +
 +
===Source===
 +
The biobrick [https://parts.igem.org/Part:BBa_I13522 BBa_I13522] was used as a template for the mutations.
  
−
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
  

Revision as of 14:26, 26 October 2012

Figure 1: cross-section view of a E-/ K-coil heterodimer'


IPTG induced promoter + GFP with a His-tag fused to a coiled coil

GFP with His tag at the C-terminus and the E-coil at the N-terminus behind an IPTG induced promoter to use it as reporter for the E- and K-coil [http://2012.igem.org/Team:Wageningen_UR/Coil_system Plug and Apply system]

Usage and Biology

The E-coil present in this reporter protein is one part of the Plug and Apply (PnA) system consisting of a combination of E- and K-coil. These coils consist of α-helical repeats and have a strong affinity to each other due to electrostatic interactions (with K-coil positively charged and E-coil negatively charged). Using this system one can bind two proteins noncovalently but specifically to each other. This brick can be used for confirmation of the Plug and Apply system using E- and K-coils as well as for detection of proteins that can be fused to the K-coil.

Figure 4: protein folding prediction of GFP (green) with a His-tag (blue) fused to a coiled coil (purple)

To be able to use the device, the counterpart of the E-coil needs to be fused to the protein that needs to be detected.


name sequence translated
K-coil (counterpart) aagatagcggcgttgaaggagaaaatcgcagcactaaaagaaaagatagcggcgttgaaggag KIAALKEKIAALKEKIAALKE
E-coil (present in the brick) gaaattgcggcgctggaaaaagaaattgcggcgctggaaaaagaaattgcggcgctggaaaaa EIAALEKEIAALEKEIAALEK

Source

The biobrick BBa_I13522 was used as a template for the mutations.

Usage and Biology

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 233
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 233
    Illegal NotI site found at 239
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 233
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 233
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 233
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1041