Difference between revisions of "Part:BBa K897624"

Revision as of 12:44, 26 September 2012

Antisense FtsZ

The antisense FtsZ fragment with the B0015 terminator, targeting the FtsZ gene in E.coli. When this part transcript in cells, it can inhibit the cell division.

To fabricate this part, we decided to utilize the FtsZ gene to manipulate the division of E.coli. Cell wall division in E. coli involves a complex series of events with the involvement of at least eight different proteins. One of the first steps in bacterial cell wall division involves the formation of the Z-ring, a circular polymeric structure formed by the cytosolic protein FtsZ.

FtsZ is a prokaryotic homologue of andα- andβ-tubulin in E.coli. And like tubulin, it conducts GTPase and polymerization activities in vitro. The exact structure of the Z ring in vivo is not known, but there has been evidence proving that it is highly dynamic, being continuously remodeled, whose frequency is almost proportional to the amount of its GTPase activities . And FtsZ can assemble into the Z-ring without the assistance of any protein so far identified. It has been demonstrated that FtsZ has a precise localization within the bacterium. Immuno-gold electron microscopy showed a diffuse localization in most cells but the Z ring of concentrated FtsZ near the membrane in cells that were about to divide. As division proceeded, the FtsZ ring constricted and remained at the tip of the invaginating membrane. In conclude, FtsZ is one of the best conserved division proteins in its family and its role in cell division traces back very early in evolution.

The primers of the target FtsZ fragments (Template: the complete genome)

F:CCGCTCGAGCAAGAAGCGTATGGCATTCG

R:GCTCTAGACATCGTTCGCTGCGCCAAAC

The restriction sites and the protect site can be changed.

Sequence and Features