Difference between revisions of "Part:BBa K823039"

Revision as of 09:37, 26 September 2012 (view source) Jara (Talk | contribs) ← Older edit		Revision as of 09:38, 26 September 2012 (view source) Jara (Talk | contribs) Newer edit →
Line 14:		Line 14:
	Find out more about our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox] and the created [http://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins '''Sporo'''beads].		Find out more about our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox] and the created [http://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins '''Sporo'''beads].
		+
		+	<br>
		+	<br>
		+	<br>
		+	<br>
		+	<br>
		+	<br>
	<!-- Add more about the biology of this part here		<!-- Add more about the biology of this part here

---

Revision as of 09:38, 26 September 2012

gfpmut1 (B. subtilis optimized + Freiburg standard) This gfpmut3 gene was amplified from pGFPamy B. subtilis vector.

It is constructed in the Freiburg standard with RBS.

Find out more about the design of our prefix with ribosome binding site.

prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

We took a gfp derivate of the Bacillus subtilis plasmids pGFPamy and added the BioBrick compatiple pre- and suffix of the Freiburg standard (Assembly 25). This BioBrick was used to create our [http://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins Sporobeads]. It is part of the BioBrick K823049

Find out more about our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks Bacillus BioBrick Box] and the created [http://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins Sporobeads].

Sequence and Features