Difference between revisions of "Part:BBa K733007"

Revision as of 08:53, 23 September 2012

Pveg promoter + spoVG RBS + lytC + helical linker + RPMrel peptide + consensus RBS + GFP + double terminator

Purpose & Intended Function

Our project seeks to design recombinant bacteria that specifically target and suppress the growth of colorectal carcinoma cells in a controllable way. Our proposed solution for the targeting issue requires the phage display peptide ‘RPMrel’ (see [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf this]) to be expressed on the surface of the bacterial vector in order for it to bind preferentially to colorectal cancer cells. Note that this construct was designed for expression in Bacillus subtilis.

This purpose is facilitated by designing this construct to strongly express RPMrel covalently linked via helical linker to the cell wall binding domain of the B. subtilis lytC protein (a cell wall hydrolase). lytC’s cell wall binding domain coding region was isolated from the code for its catalytic site by the Imperial College London’s 2010 team (see their part here).

To facilitate imaging of the recombinant bacteria during characterization of binding ability (see below), a GFP reporter construct was ligated to the binding module for expression under the same promoter. When washing fixed colorectal cancer cells with the recombinant bacteria the position of the bacteria can be identified. The reporter gene also simplified this part’s construction.

Subpart Description

Pveg (promoter). A high expression constitutive promoter for B. subtilis also shown to function in Escherichia coli (useful property for any team intending to construct using E. coli). This part was engineered for high expression and originally submitted by Imperial College London’s 2008 team (see their part page here).

spoVG (RBS). An endogenous B. subtilis RBS. Natural function is expression of the spoVG gene product, which functions in sporulation initiation control (see this).

lytC (hydrolase cell wall binding domain). 2-954bp {check this} region of the 1491bp coding sequence of the lytC protein. Isolated and submitted as a BioBrick by Imperial College London’s 2010 team (details here).

(EAAAK)n type helical linker. Stiff, long helical linker designed to separate fusion proteins with minimal disturbance to the function of both proteins. Features distinct 6 amino acid short linker sequence (SRGSRA) at N-terminal. This sequence was included in construction of the recombinant fusion protein lytC - 3xFLAG by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC262103/pdf/0628.pdf Yamamoto et al (2003)] to allow localization of the lytC protein on the cell wall.

RPMrel peptide. 9 amino acid heptapeptide screened out of NEB’s Ph.D.-C7C phage display library (see [http://www.neb.com/nebecomm/products/producte8100.asp this]) for preferential binding to poorly-differentiated colon carcinoma cells.

B. subtilis Consensus RBS. Sequence contains the Shine-Dalgarno sequence complementary to the 3’ end of 16S ribosomal RNA in B. subtilis.

GFP. Sequence for expression of the reporter gene GFPmut3b confers the ability to generate green fluorescence with emission at wavelength 511nm (find part here). GFPmut3b is a mutated variant of wild type GFP featuring 2 amino acid substitutions for enhanced fluorescence (see [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC106249/pdf/am001902.pdf this]).

Double terminator. Reliable termination sequence codes mRNA that forms 3 hairpins. See part here.

Part Source

Pveg, spoVG (RBS), the cell wall binding domain of lytC and the helical linker are all components of Imperial College London's 2010 team's detection module. These components allow high expression of any tags subsequently attached to the linker on the cell wall of Bacillus subtilis.

The coding sequence of the screened phage display peptide 'RPMrel' was produced via codon optimization of RPMrel's amino acid sequence for Bacillus subtilis. This amino acid sequence (n-CPIEDRPMC-c) came out of work conducted by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf Kelly & Jones (2003)] to isolate colon tumor specific binding peptides from New England Biolabs' 'PhD-CX7C' phage display peptide library.

Design Considerations

Construction of this part in submission form was performed in the roundabout manner detailed below.

1) PCR amplification of Pveg + spoVG RBS + lytC + linker + FLAGTM region using BBa_K316037 as the template.

Forward primer design: 5’ – [6bp cap] [20bp overlap with standard prefix] – 3’

Forward primer sequence: 5’ – GATCATGAATTCGCGGCCGCTTCTAG – 3’ (26bp)

Reverse primer design: 5' – [8bp cap] [7bp SpeI restriction site] [6bp reverse-complementary double stop codon] [24bp reverse-complementary sequence of codon optimized FLAGTM] [15bp reverse-complementary overlap with linker] - 3'

Reverse primer sequence: 5’ – GTTTCTTCACTAGTATTATTATTTATCATCATCATCTTTATAATCGGCCGCGGCTTTCGC – 3’ (60bp)

It was discovered that the transposon insAB had been inserted within the lytC coding region of the K316037 plasmid we had used for amplification. Thus it was decided to amplify a ‘safe’ copy of the 1-954bp region of lytC and the linker + FLAGTM sequence separately after which overlapping PCR would be used to join them.

2) PCR amplification of 1-954bp lytC from the B. subtilis genome. Forward primer design: 5’ – [6bp cap] [7bp XbaI restriction site] [30bp overlap with lytC] – 3’

Forward primer sequence: 5’ – GATCATTCTAGAGTTGCGTTCTTATATAAAAGTCCTAACAATG – 3’ (43bp)

Reverse primer design: 5’ – [27bp reverse-complementary overlap with lytC] – 3’

Reverse primer sequence: 5’ – TACAACTGGATTCTTTAGCTGATTAGC – 3’ (27bp)

3) PCR amplification of linker + FLAGTM from existing construct. Forward primer design: 5’ – [31bp overhang overlapping with lytC] [19bp overlap with linker] – 3’

Forward primer sequence: 5’ – GGTTGCTAATCAGCTAAAGAATCCAGTTGTAAGCAGAGGCTCACGCGCAC – 3’ (50bp)

Reverse primer design: 5’ – [8bp cap] [6bp BamHI restriction site] [7bp SpeI restriction site] [31bp overlap with FLAGTM and linker sequence] – 3’

Reverse primer sequence: 5’ – GTTTCTTCGGATCCACTAGTATTATTATTTATCATCATCATCTTTATAATCG – 3’ (52bp)

NB. This reverse primer was originally intended to allow PCR addition of a BamHI site to the 3’ end of the construct. This would allow it to be ligated into the multiple cloning site of integration vector pDG1661. That function was never pursued and the primer was recycled for use here.

4) Overlapping PCR linking products from steps 2 and 3.

5) Ligation into standard backbone pSB1C3. Following successful PCR the PCR product and pSB1C3 were digested with XbaI and SpeI. The two digestion products were then ligated together.