Difference between revisions of "Part:BBa K823034"

Revision as of 12:11, 8 September 2012

3x FLAG tag (Freiburg standard+RBS)

3x FLAG tag with RBS in Freiburg standard.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

3x Flag tag

HA-tag

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Sequence and Features

Assembly Compatibility:

Revision as of 11:49, 8 September 2012 (view source) Dexios (Talk \| contribs) ← Older edit		Revision as of 12:11, 8 September 2012 (view source) Dexios (Talk \| contribs) Newer edit →
Line 2:		Line 2:
	<partinfo>BBa_K823034 short</partinfo>		<partinfo>BBa_K823034 short</partinfo>

−	3x ~~Flag~~ tag with RBS in [[Help:Assembly_standard_25\|Freiburg standard]].	+	3x FLAG tag with RBS in [[Help:Assembly_standard_25\|Freiburg standard]].