Difference between revisions of "Part:BBa K823036"

Revision as of 10:01, 8 September 2012

cMyc-tag (Freiburg standard+RBS)

cMyc-tag with RBS in Freiburg standard.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Sequence and Features

Assembly Compatibility:

Revision as of 10:00, 8 September 2012 (view source) Dexios (Talk \| contribs) ← Older edit		Revision as of 10:01, 8 September 2012 (view source) Dexios (Talk \| contribs) Newer edit →
Line 13:		Line 13:
	This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:		This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

−	[[Part:BBa_K823034\|3x Flag tag]],[[Part:BBa_K823035\|HA-tag]],[[Part:BBa_K823036\|cMyc-tag]],[[Part:BBa_K823037\|~~3x Flag~~ tag]],[[Part:BBa_K823038\|~~3x Flag tag~~]]	+	[[Part:BBa_K823034\|3x Flag tag]],[[Part:BBa_K823035\|HA-tag]],[[Part:BBa_K823036\|cMyc-tag]],[[Part:BBa_K823037\|His-tag]],[[Part:BBa_K823038\|Streptavidin]]