Difference between revisions of "Part:BBa K594001:Design"
(→part verification) |
|||
Line 13: | Line 13: | ||
The Sinorhizobium meliloti 1021 is got from Nanjing Agricultural University. The professor Zhu Jun and lecturer Zheng Huiming have applied the sinI gene and use it for functional gene expression.Usually, they will use the C18 reverse TLC to verify if the sinI have expressed itself. | The Sinorhizobium meliloti 1021 is got from Nanjing Agricultural University. The professor Zhu Jun and lecturer Zheng Huiming have applied the sinI gene and use it for functional gene expression.Usually, they will use the C18 reverse TLC to verify if the sinI have expressed itself. | ||
− | [[Image: | + | [[Image:sinI.jpg]]<br> |
AS long as the sinI's sequence is right, it can have a right expression, producing the AHLs C12-HSL、3-Oxo-C14-HSL、C16:1-HSL、3-Oxo-C16:1-HSL、C18-HSL. | AS long as the sinI's sequence is right, it can have a right expression, producing the AHLs C12-HSL、3-Oxo-C14-HSL、C16:1-HSL、3-Oxo-C16:1-HSL、C18-HSL. | ||
Line 31: | Line 31: | ||
So the sinI is right, when added proper promoter and RBS, it will work, producing AHLs C12-HSL、3-Oxo-C14-HSL、C16:1-HSL、3-Oxo-C16:1-HSL、C18-HSL. | So the sinI is right, when added proper promoter and RBS, it will work, producing AHLs C12-HSL、3-Oxo-C14-HSL、C16:1-HSL、3-Oxo-C16:1-HSL、C18-HSL. | ||
− | |||
− | |||
===Source=== | ===Source=== |
Revision as of 03:09, 6 October 2011
a luxI homologous AHL synthetase from Sinorhizobium meliloti 1021
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
The Sinorhizobium meliloti 1021 is a mode organism in Rhizobia. We looked for the papers related to the Quorum Sensing systems in S. meliloti Rm 1021, and then found the specific sequence in NCBI and asked the S. meliloti Rm 1021 strain from Nanjing Agricultural University. The SinI/R system have no threats to biosafety.
part verification
The Sinorhizobium meliloti 1021 is a mode organism, it has been characterized most in the rhizobia. Especially the sinI, it has been applied by many functional gene researcher.
The Sinorhizobium meliloti 1021 is got from Nanjing Agricultural University. The professor Zhu Jun and lecturer Zheng Huiming have applied the sinI gene and use it for functional gene expression.Usually, they will use the C18 reverse TLC to verify if the sinI have expressed itself.
AS long as the sinI's sequence is right, it can have a right expression, producing the AHLs C12-HSL、3-Oxo-C14-HSL、C16:1-HSL、3-Oxo-C16:1-HSL、C18-HSL.
We have sent the sinI to the sequencing center, and it proves that it is 100% correct.
the sequecing result,
AATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGATGATCAGGATAGTGAACGGAAACGGTCGCAGCCAGCACCCCCAGGCCATCGACGAGATGTTCCGGCTGCGTAAGCGCGTGTTCCACGACTTCTTGAAATGGGACGTCAAGACCGAAGGGGACTGGGAAATCGACCACTACGACAAGGCCAATCCGCTCTATGTCATGTCGTACTCGCCGGACACCGGCAAGATTCGTGGCTCCCTCAGGCTCCTTCCGACGCTCGGTCCGAATATGCTGGACGATACGTTCCCGATCCTGCTCGGGGACAATCCGGAAATCCGTAGTGCGTCGGTGTGGGAATCGAGCCGCTTCTGCATCGATCCCGAAATCTCCCAGGATCGCGCATCGAACCAGGTCACCATCGCCGCGGCCGAACTGATGTGCGGTGTGGGCGAAATGAGCCTTGCCTCGGGCATCAGCCATATCGTCACGGTCACCGATGTGTTCCTGGAGCGAATGTTCCGCCGCATGGGTTGCCCTGGGGAGCGCATCGCCGATCCGCACAGGATCGGCTCCGTCCATGCGGTCGCCATCGCGTGGGAGGTGAGC AGGAACCTGCTCGAAACGATGAAGGCGGTGGCCTCCATCGAGGGCACCGTTCTCGATCGCCCGATGTCGCTTGAAACGGCACGCGCCGCCTGATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTCGCGCGGAATC
We use NCBI blast to analysis the sequence, finally get the result.
>lcl|23903 Length=645
Score = 1192 bits (645), Expect = 0.0 , Identities = 645/645 (100%), Gaps = 0/645 (0%) Strand=Plus/Plus
So the sinI is right, when added proper promoter and RBS, it will work, producing AHLs C12-HSL、3-Oxo-C14-HSL、C16:1-HSL、3-Oxo-C16:1-HSL、C18-HSL.
Source
We got the S. meliloti 1021 from Nanjing Agriculture University, and then cloned the sinI gene from S. meliloti 1021 with primers designed by the part design tool in the website [ginkgobioworks.com]. We get its gene sequence from the www.microbesonline.org, and then cloned them through PCR with biobrick part primers.
References
1.Melanie M. Marketon and Juan E. González. 2002.Identification of Two Quorum-Sensing Systems in Sinorhizobium meliloti. JOURNAL OF BACTERIOLOGY, p. 3466–3475July 2002
2.Melanie M. Marketon, Matthew R. Gronquist,2 Anatol Eberhard,3 and Juan E. Gonza´lez1. 2002,Characterization of the Sinorhizobium meliloti sinR/sinI Locus and the Production of Novel N-Acyl Homoserine Lactones,JOURNAL OF BACTERIOLOGY, p. 5686–5695
3.Juan E. Gonza´lez and Melanie M. Marketon. 2003, Quorum Sensing in Nitrogen-Fixing Rhizobia, MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, p. 574–592