Difference between revisions of "Part:BBa K584015"

Latest revision as of 14:41, 21 September 2011

Lambda cI and LuxR regulated hybrid promoter + Ribolock-CeaB + Terminator

We performed a PCR to get the CeaB part of the K131009 biobrick. The primer design for this was such that it already contained the ribolock resulting in ‘Ribolock + ceaB’ as the final product. This was fused with the terminator B0015 to get ‘Ribolock + ceaB + B0015’. This was finally fused with the Lambda cI and LuxR regulated hybrid promotor to get this biobrick, ‘Lambda_cI and LuxR_regulated hybrid promotor’ + Ribolock + ceaB + B0015.

The primer sequence we used in the PCR reaction is -

ceaB-FW: CCGGAATTCGCGGCCGCTTCTAGAGAACTAGAATCACCTCTTGCTTTTGGGTAAGACGAAGAGGAGATACTAGATGAGCGGTGGCGATGGACGC

ceaB-RV: AAAACTGCAGCGGCCGCTACTAGTCTCTAGTATTACTTACCCCGATGAATATCAATAT

Ribolock

The second part of the cell death mechanism of the K.U.Leuven iGEM 2011 project E.D. Frosti works via a ribokey-ribolock system. The ribokey is under the control of the HybB cold-sensitive promoter (BBa_J45503), which will only be switched on when E.D. Frosti senses a dramatic drop in temperature. So when the ribokey isn’t transcribed, the ribolock mRNA will form a hairpin structure. Since ribosomes cannot access double stranded mRNA, there will be no translation of the CeaB gene.

Hence, to activate the cell death mechanism, E.D. Frosti needs to undergo a cold-shock treatment.E.D. Frosti will ‘sense’ the change in temperature and the ribokey will be transcribed. This ribokey will bind to the ribolock, followed by the opening of the double-stranded mRNA hairpin loop. Under these conditions, ribosomes can bind and translate the CeaB gene. CeaB is a DNase, which can be found in the Colicin E2 operon.

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

@@ Line 2: / Line 2: @@
 <partinfo>BBa_K584015 short</partinfo>
-We performed a '''PCR''' to get the '''CeaB''' part of the '''K131009 biobrick'''. The primer design for this was such that it already contained the ribolock resulting in ‘'''Ribolock''' + '''ceaB'''’ as the final product.  This is fused with the terminator B0015 to get ‘Ribolock + ceaB + B0015’. This was finally fused with the Lambda cI and LuxR regulated hybrid promotor to get  this biobrick, ‘Lambda_cI and LuxR_regulated hybrid promotor’ + Ribolock + ceaB + B0015.
+We performed a '''PCR''' to get the '''CeaB''' part of the '''K131009 biobrick'''. The primer design for this was such that it already contained the ribolock resulting in ‘'''Ribolock''' + '''ceaB'''’ as the final product.  This was fused with the terminator B0015 to get ‘Ribolock + ceaB + B0015’. This was finally fused with the Lambda cI and LuxR regulated hybrid promotor to get  this biobrick, ‘Lambda_cI and LuxR_regulated hybrid promotor’ + Ribolock + ceaB + B0015.
 The primer sequence we used in the PCR reaction is -
@@ Line 12: / Line 12: @@
 '''Ribolock'''
-The second part of the cell death mechanism of the K.U.Leuven iGEM 2011 project E.D. Frosti works via a ribokey-ribolock system. The ribokey is under the control of the HybB cold-sensitive promoter (BBa_J45503), which will only be switched on when E.D. Frosti senses a dramatic drop of the temperature. So when the ribokey isn’t transcribed, the ribolock mRNA will form a hairpin structure. Since ribosomes cannot access double stranded mRNA, there will be no translation of the CeaB gene.
+The second part of the cell death mechanism of the K.U.Leuven iGEM 2011 project E.D. Frosti works via a ribokey-ribolock system. The ribokey is under the control of the HybB cold-sensitive promoter (BBa_J45503), which will only be switched on when E.D. Frosti senses a dramatic drop in temperature. So when the ribokey isn’t transcribed, the ribolock mRNA will form a hairpin structure. Since ribosomes cannot access double stranded mRNA, there will be no translation of the CeaB gene.
 Hence, to activate the cell death mechanism, E.D. Frosti needs to undergo a cold-shock treatment.E.D. Frosti will ‘sense’ the change in temperature and the ribokey will be transcribed. This ribokey will bind to the ribolock, followed by the opening of the double-stranded mRNA hairpin loop. Under these conditions, ribosomes can bind and translate the CeaB gene. '''CeaB''' is a DNase, which can be found in the Colicin E2 operon.