Difference between revisions of "Part:BBa K638402:Experience"
(→‎Producing BBa_k638402 from primer synthesis)
Line 11: Line 11:
 
We assembled the basic part by using a pair of primers that will anneal to give the whole sequence. Biobrick prefixes and suffixes can then be added to create an in-frame fusion by assembly techniques such as [https://parts.igem.org/Plasmid_backbones/Assembly_of_protein_fusions BBF RFC 23 or 25].  Alternatively, Cambridge 2011 created scar-free fusions of this export tag to our protein of interest by [http://www.cambridgeigem.org/RFC57.pdf Gibson Assembly].
 
We assembled the basic part by using a pair of primers that will anneal to give the whole sequence. Biobrick prefixes and suffixes can then be added to create an in-frame fusion by assembly techniques such as [https://parts.igem.org/Plasmid_backbones/Assembly_of_protein_fusions BBF RFC 23 or 25].  Alternatively, Cambridge 2011 created scar-free fusions of this export tag to our protein of interest by [http://www.cambridgeigem.org/RFC57.pdf Gibson Assembly].
  
−
<html>
 
 
<table border="1" style="text-align:center;word-wrap:break-word;width:700px;table-layout:fixed;">
 
<table border="1" style="text-align:center;word-wrap:break-word;width:700px;table-layout:fixed;">
 
<tr>
 
<tr>
Line 28: Line 27:
 
   <td>70.98&deg;C</td>
 
   <td>70.98&deg;C</td>
 
</tr>
 
</tr>
−
</html>
 
  
−
Thermocycler profile:
 
  
 +
Thermocycler profile:
  
 
===User Reviews===
 
===User Reviews===

Revision as of 10:50, 21 September 2011

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K638402

This is an improved version of part BBa_K233307 designed to allow comparison with measurements of functionality in the literature, and to make it easier to synthesise.

Producing BBa_k638402 from primer synthesis

We assembled the basic part by using a pair of primers that will anneal to give the whole sequence. Biobrick prefixes and suffixes can then be added to create an in-frame fusion by assembly techniques such as BBF RFC 23 or 25. Alternatively, Cambridge 2011 created scar-free fusions of this export tag to our protein of interest by [http://www.cambridgeigem.org/RFC57.pdf Gibson Assembly].

Thermocycler profile:

User Reviews

UNIQ493962adabf40595-partinfo-00000000-QINU

UNIQ493962adabf40595-partinfo-00000001-QINU
Name Sequence Tm
TorA Fwd ATGGCGAACAACGACTTATTTCAGGCTTCTCGGCGTCGCTTTCTGGCGCAGCTGGGCGGATTAACGGTGGCGGGT 70.98°C
TorA Rev TGCGGCTTGTGCTGCCGTCGCTCTGCGAGGAGTCAACAGCGACGGGCCCAACATACCCGCCACCGTTAATCCGCC 70.98°C