Difference between revisions of "Part:BBa K584004"

Revision as of 07:15, 21 September 2011

HybB promoter + GFP generator

This part was designed to test the functionality of the promotor region. We cloned the HybB promoter via PCR using the K410000 as a template using the primers below -

hyb-FW: CCGGAATTCGCGGCCGCTTCTAGAGCGCCGCTATGGACTGGATAAAG

hyb-RV: AAAACTGCAGCGGCCGCTACTAGTATGCTACTTAACCCCATGGTGG

Characterization

To test the usefulness of the cold shock-inducible promoter J45503 in our 2011 iGEM project, we fused the promoter to a GFP reporter, and assayed the promoter’s activity after a temperature shift from 37°C to 25°C or 4°C. We tested this activity both in a TOP10F’ (figure 1) as well as a MG1655 (figure 2) E.coli strain background. For more information on E.coli strain descriptions, we recommend the following web site: [http://openwetware.org/wiki/E._coli_genotypes E.Coli_Genotypes].

Figure1

Figure2

We can see clearly that transferring cells (both TOP10F’ and MG1655) to lower temperatures (4°C and even 25°C) results in a growth arrest between the 1 and 4 hour time points of our experiment (Figures 1A and 2A). We see that promoter activity is induced when cells are transferred to 25°C and even when they are put in and ice bath (4°C) (Figures 1B and 2B). Unfortunately, however, cells that are kept at 37°C also display an increase in promoter activity, indicating leakiness in the system.

Sequence and Features