Difference between revisions of "Part:BBa K091107:Experience"
(→User Reviews) |
(→User Reviews) |
||
| Line 21: | Line 21: | ||
Andrew Kirk, undergraduate, Penn State iGEM 2010 | Andrew Kirk, undergraduate, Penn State iGEM 2010 | ||
| − | Two Lux-inducible promoters that were already on the registry (K091107 and K091146) were characterized. Because these promoters require AHL and LuxR in order to activate, a construct was created that consisted of a Lux promoter followed by RFP, and a constitutive promoter followed by the LuxR gene. LuxR was expected to be present in excess so that the limiting factor would be AHL. The coding sequences for LuxR and RFP were preceded by the standard RBS B0034. | + | Two Lux-inducible promoters that were already on the registry (K091107 and K091146) were characterized. Because these promoters require AHL and LuxR in order to activate, a construct was created that consisted of a Lux promoter followed by RFP, and a constitutive promoter followed by the LuxR gene. LuxR was expected to be present in excess so that the limiting factor would be AHL. The coding sequences for LuxR and RFP were preceded by the standard RBS B0034. The LuxR part used was [https://parts.igem.org/wiki/index.php?title=Part:BBa_K376010 K376010], which was just added to the registry by Penn State 2010. Using the Voigt RBS calculator, it was predicted that the translation initiation rate for expression of this gene was 246720 au. |
The AHL used was OC6-homoserine lactone. It was added to samples in a 96-well plate in concentrations of 0, .1, 1, 10, 100 and 1000nM. | The AHL used was OC6-homoserine lactone. It was added to samples in a 96-well plate in concentrations of 0, .1, 1, 10, 100 and 1000nM. | ||
| − | The results [http://2010.igem.org/Team:Penn_State/Project#Lux_Promoter_Characterization on our wiki] show no trend in protein expression based on concentration of OC6-homoserine lactone. More research is warranted to provide information about what are the best conditions for chemically inducing the Lux promoters. | + | The results shown below and [http://2010.igem.org/Team:Penn_State/Project#Lux_Promoter_Characterization on our wiki] show no trend in protein expression based on concentration of OC6-homoserine lactone. More research is warranted to provide information about what are the best conditions for chemically inducing the Lux promoters. |
| + | |||
| + | [image:1107_108.png] | ||
| + | |||
| + | [1107_116_Tet.png] | ||
In addition, sequencing results indicated that the intended sequence for K091107 was actually substituted for | In addition, sequencing results indicated that the intended sequence for K091107 was actually substituted for | ||
Revision as of 05:50, 4 November 2010
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K091107
User Reviews
UNIQc0bb1ab26bbc9ada-partinfo-00000000-QINU UNIQc0bb1ab26bbc9ada-partinfo-00000001-QINU
Andrew Kirk, undergraduate, Penn State iGEM 2010
Two Lux-inducible promoters that were already on the registry (K091107 and K091146) were characterized. Because these promoters require AHL and LuxR in order to activate, a construct was created that consisted of a Lux promoter followed by RFP, and a constitutive promoter followed by the LuxR gene. LuxR was expected to be present in excess so that the limiting factor would be AHL. The coding sequences for LuxR and RFP were preceded by the standard RBS B0034. The LuxR part used was K376010, which was just added to the registry by Penn State 2010. Using the Voigt RBS calculator, it was predicted that the translation initiation rate for expression of this gene was 246720 au.
The AHL used was OC6-homoserine lactone. It was added to samples in a 96-well plate in concentrations of 0, .1, 1, 10, 100 and 1000nM.
The results shown below and [http://2010.igem.org/Team:Penn_State/Project#Lux_Promoter_Characterization on our wiki] show no trend in protein expression based on concentration of OC6-homoserine lactone. More research is warranted to provide information about what are the best conditions for chemically inducing the Lux promoters.
[image:1107_108.png]
[1107_116_Tet.png]
In addition, sequencing results indicated that the intended sequence for K091107 was actually substituted for
AACCGTGAAAATCAAAATAGCATAAATTGTGATCTATTCGTCGGAAATATGTGCAATGTCCACCTAAGGTTATGAACAAATTAAAAGCAGAAATACATTTAACACCGTGCGTGTTGAAGATTTTACCTCTGGCGGTGATAA
It would be helpful to know if any other teams experienced similar results.