Difference between revisions of "Part:BBa K358019:Experience"
(→Applications of BBa_K358019) |
|||
Line 5: | Line 5: | ||
===Applications of BBa_K358019=== | ===Applications of BBa_K358019=== | ||
Using this part, we checked the function of SRRz gene. | Using this part, we checked the function of SRRz gene. | ||
+ | |||
+ | Experiment1 Characterization of lytic activity with time | ||
+ | |||
+ | To characterize the lytic activity of λ lysis cassette in more detail, we focused on when cell lysis occurs after induction of IPTG. We did the experiment as this [[Team:Kyoto/Protocols#Measurement of lytic activity with time | protocol]], we got the following data | ||
+ | |||
+ | [[Image:KyotoGrp101028-1.png|600px|center]] | ||
+ | |||
+ | [[Image:KyotoPhoto2a.jpg|300px|left]][[Image:KyotoPhoto4a.jpg|300px|left]][[Image:KyotoPhoto7a.jpg|300px]] | ||
+ | {{clear}} | ||
+ | Please see our [[Team:Kyoto/Notebook|notebook]]. There is much data about the relationship between cell lysis and the concentration of IPTG. | ||
+ | {{clear}} | ||
+ | [[Image:KyotoGrp101026-1.png|300px]] | ||
+ | [[#top-section|^Top]] | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
Firstly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX. | Firstly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX. |
Revision as of 21:25, 30 October 2010
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K358019
Using this part, we checked the function of SRRz gene.
Experiment1 Characterization of lytic activity with time
To characterize the lytic activity of λ lysis cassette in more detail, we focused on when cell lysis occurs after induction of IPTG. We did the experiment as this protocol, we got the following data
300pxTemplate:Clear Please see our notebook. There is much data about the relationship between cell lysis and the concentration of IPTG. Template:Clear 300px ^Top
Firstly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX.
It is necessary to repress the lactose promoter and avoid the disadvantage of cell lysis.
Secondly, we cultured samples on M9-Km 30C/overnight.
Experiment 1:
Then, diluted the sample and added IPTG as the inducer. We measured A550 at each time.
Experiment 2:
We added IPTG, not dilute the sample. We measured A550 at each time.
Finally,
Culture condition:
We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end. We done the sequencing on this sample.
BBa_R0011: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca
Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca
To avoid the mutation, we finally decided the cultural temperature at 30C.
User Reviews
UNIQ487969bebdebd208-partinfo-00000000-QINU UNIQ487969bebdebd208-partinfo-00000001-QINU