Difference between revisions of "Part:pSB1K16"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>pSB1K16 short</partinfo>
 
<partinfo>pSB1K16 short</partinfo>
  
−
Part made by MIT 2010 iGEM Team
+
Made by MIT 2010 iGEM Team.
 +
 
 +
[[Image:L1_EGFP_L2_image.jpg|thumb|right|Figure 1. Example of a L1L2 Promoter Entry Vector.]]
 +
 
 +
The MIT iGEM Team is excited to introduce the new Mammalian Standard: MammoBlocks, a system based on recombination sites using Invitrogen's Gateway technology.
 +
 
 +
Recombination cloning is a quick and efficient process, already widely used in scientific community as a protocol for vector assembly. Invitrogen has standardized and simplified this process; their system, Gateway® Cloning, involves the use of two different bacteriophage recombination enzymes to allow for the assembly of an expression vector from two ‘part’-containing vectors--the '''entry vectors'''. This process is extremely robust (up to 99% recombination efficiency), and circumvents many of the more laborious steps involved in traditional restriction cloning, such as separate ligation and digestion procedures.
 +
 
 +
MammoBlock gene entry vectors are defined by the presence of attL1 and attL2 recombination sites flanking the gene insert. We require that MammoBlock L1L2 Gene Vectors contain the following sequence structure around the insert (or ‘part’), which allow for insertion of the gene directly in behind the promoter during the Gateway©
 +
reaction :
 +
 
 +
5’ _attL1 site_--------Insert--------_attL2 site_3’
 +
 
 +
att_L1 Recombination Site Sequence:
 +
 
 +
5’CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT3’
 +
 
 +
 
 +
att_L2 Recombination Site Sequence:
 +
 
 +
5’ACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG3’
 +
 
 +
 
 +
An example is shown in Figure 1 of an L1L2 MammoBlock part containing the gene fluorescent protein EGFP. We submit this vector, with biobrick designation pSB1K16 as the first MammoBlock backbone for promoter entry vectors.
 +
 
 +
Insert ‘Part’ Sequencing Primers for pSB1K16:
 +
* M13 (-20) forward primer: 5’CATTTTGCTGCCGGTC 3’
 +
* M13 reverse primer: 5’CAGGAAACAGCTATGAC 3’
 +
 
 +
* pSB1K16 Bacterial Antibiotic Resistance: Kanamycin
  
−
<!-- Add more about the biology of this part here
+
'''Please see our RFC document for full MammoBlock Documentation. [https://static.igem.org/mediawiki/2010/3/3e/Mammoblock_RFC_Draft.pdf]'''
−
===Usage and Biology===
+
  
−
<!-- -->
+
==Sequence and Features==
−
<span class='h3bb'>Sequence and Features</span>
+
 
<partinfo>pSB1K16 SequenceAndFeatures</partinfo>
 
<partinfo>pSB1K16 SequenceAndFeatures</partinfo>
  

Revision as of 04:56, 29 October 2010

Gateway entry vector for gene cassette (L1L2)

Made by MIT 2010 iGEM Team.

Figure 1. Example of a L1L2 Promoter Entry Vector.

The MIT iGEM Team is excited to introduce the new Mammalian Standard: MammoBlocks, a system based on recombination sites using Invitrogen's Gateway technology.

Recombination cloning is a quick and efficient process, already widely used in scientific community as a protocol for vector assembly. Invitrogen has standardized and simplified this process; their system, Gateway® Cloning, involves the use of two different bacteriophage recombination enzymes to allow for the assembly of an expression vector from two ‘part’-containing vectors--the entry vectors. This process is extremely robust (up to 99% recombination efficiency), and circumvents many of the more laborious steps involved in traditional restriction cloning, such as separate ligation and digestion procedures.

MammoBlock gene entry vectors are defined by the presence of attL1 and attL2 recombination sites flanking the gene insert. We require that MammoBlock L1L2 Gene Vectors contain the following sequence structure around the insert (or ‘part’), which allow for insertion of the gene directly in behind the promoter during the Gateway© reaction :

5’ _attL1 site_--------Insert--------_attL2 site_3’

att_L1 Recombination Site Sequence:

5’CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCT3’


att_L2 Recombination Site Sequence:

5’ACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG3’


An example is shown in Figure 1 of an L1L2 MammoBlock part containing the gene fluorescent protein EGFP. We submit this vector, with biobrick designation pSB1K16 as the first MammoBlock backbone for promoter entry vectors.

Insert ‘Part’ Sequencing Primers for pSB1K16:

  • M13 (-20) forward primer: 5’CATTTTGCTGCCGGTC 3’
  • M13 reverse primer: 5’CAGGAAACAGCTATGAC 3’
  • pSB1K16 Bacterial Antibiotic Resistance: Kanamycin

Please see our RFC document for full MammoBlock Documentation. [1]

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
  • 12
    INCOMPATIBLE WITH RFC[12]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal NheI site found at 2115
    Illegal NheI site found at 2381
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
  • 23
    INCOMPATIBLE WITH RFC[23]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
  • 25
    INCOMPATIBLE WITH RFC[25]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal SapI.rc site found at 1992