Difference between revisions of "Part:pSB1K15"

Revision as of 04:48, 29 October 2010

Gateway entry vector for promoters (L4R1)

Made by the 2010 MIT iGEM Team

Figure 1. Example of a L4R1 Promoter Entry Vector.

The MIT iGEM Team is excited to introduce the new Mammalian Standard: MammoBlocks, a system based on recombination sites using Invitrogen's Gateway technology.

Recombination cloning is a quick and efficient process, already widely used in scientific community as a protocol for vector assembly. Invitrogen has standardized and simplified this process; their system, Gateway® Cloning, involves the use of two different bacteriophage recombination enzymes to allow for the assembly of an expression vector from two ‘part’-containing vectors--the entry vectors. This process is extremely robust (up to 99% recombination efficiency), and circumvents many of the more laborious steps involved in traditional restriction cloning, such as separate ligation and digestion procedures.

The promoter entry vectors are characterized by attL4 and attR1 recombination sites flanking the insert; this design places the promoter directly in front of the gene after a multisite Gateway© reaction. We require that a MammoBlock L4R1 promoter entry vector have the following sequence structure around the insert. Note that here we define the ‘part’ as the entire region between the flanking attL4 and attR1 sites.

5’ _attL4 site_--------Insert--------_attR1_site_3’

att_L4 Recombination Site Sequence: 5’CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAG CAATGCTTTTTTATAATGCCAACTTTGTATAGAAAAGTTG 3’

att_R1 Recombination Site Sequence: 5’CCAAGTTTGTACAAAAAAGTTGAACGAGAAACGTAAAATGATATAAATATCAATATA TTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATGCA GTCACTATG 3’

A schematic of the promoter entry vector can be seen in Figure 1.

Insert ‘Part’ Sequencing Primers for pSB1K15:

• M13 (-20) forward primer: 5’CATTTTGCTGCCGGTC 3’
• M13 reverse primer:5’CAGGAAACAGCTATGAC 3’
• pSB1K15 Bacterial Antibiotic Resistance: Kanamycin

L4R1 Entry Vector Assembly

One noteworthy feature of the the L4R1 backbone plasmid above is the existence of convenient directional restriction sites between the recombination sites and the promoter sequence; these are not a required feature of MammoBlock backbones, but they can simplify entry vector construction. The following is an optional method for restriction cloning promoters into the pSB1K15 backbone.

Insert ‘parts’ for this cloning procedure should be fabricated in the following format:

BsrgI cuts inside the attR1 recombination site; the fragment in the digested insert replaces the cut portion of attR1.

Digestion of pSB1K15 with PacI and BsrgI yields ‘sticky’ ends of the form

between the attL4 and attR1 recombination sites, respectively. Cutting the insert with PacI and BsrgI and ligating into digested vector yield the final product:

Note that this cloning step is directional; the ligation will yield a promoter in the correct orientation.

Sequence and Features