Difference between revisions of "Part:pSB1K15"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>pSB1K15 short</partinfo>
 
<partinfo>pSB1K15 short</partinfo>
Line 5: Line 4:
 
Made by the 2010 MIT iGEM Team
 
Made by the 2010 MIT iGEM Team
  
−
<!-- Add more about the biology of this part here
+
The MIT iGEM Team is excited to introduce the new Mammalian Standard: MammoBlocks, a system based on recombination sites using Invitrogen's Gateway technology.
−
===Usage and Biology===
+
 
 +
Recombination cloning is a quick and efficient process, already widely used in scientific community as a protocol for vector assembly. Invitrogen has standardized and simplified this process; their system, Gateway® Cloning, involves the use of two different bacteriophage recombination enzymes to allow for the assembly of an expression vector from two ‘part’-containing vectors--the '''entry vectors'''. This process is extremely robust (up to 99% recombination efficiency), and circumvents many of the more laborious steps involved in traditional restriction cloning, such as separate ligation and digestion procedures.
 +
 
 +
The promoter entry vectors are characterized by attL4 and attR1 recombination sites flanking the insert; this design places the promoter directly in front of the gene after a multisite Gateway© reaction. We require that a MammoBlock L4R1 promoter entry vector have the following sequence structure around the insert. Note that here we define the ‘part’ as the entire region between the flanking attL4 and attR1 sites.
 +
5’ _attL4 site_--------Insert--------_attR1_site_3’
 +
att_L4 Recombination Site Sequence:
 +
5’CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAG CAATGCTTTTTTATAATGCCAACTTTGTATAGAAAAGTTG 3’
 +
att_R1 Recombination Site Sequence:
 +
5’CCAAGTTTGTACAAAAAAGTTGAACGAGAAACGTAAAATGATATAAATATCAATATA TTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATGCA GTCACTATG 3’
 +
 
  
−
<!-- -->
 
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>pSB1K15 SequenceAndFeatures</partinfo>
 
<partinfo>pSB1K15 SequenceAndFeatures</partinfo>

Revision as of 04:32, 29 October 2010

Gateway entry vector for promoters (L4R1)

Made by the 2010 MIT iGEM Team

The MIT iGEM Team is excited to introduce the new Mammalian Standard: MammoBlocks, a system based on recombination sites using Invitrogen's Gateway technology.

Recombination cloning is a quick and efficient process, already widely used in scientific community as a protocol for vector assembly. Invitrogen has standardized and simplified this process; their system, Gateway® Cloning, involves the use of two different bacteriophage recombination enzymes to allow for the assembly of an expression vector from two ‘part’-containing vectors--the entry vectors. This process is extremely robust (up to 99% recombination efficiency), and circumvents many of the more laborious steps involved in traditional restriction cloning, such as separate ligation and digestion procedures.

The promoter entry vectors are characterized by attL4 and attR1 recombination sites flanking the insert; this design places the promoter directly in front of the gene after a multisite Gateway© reaction. We require that a MammoBlock L4R1 promoter entry vector have the following sequence structure around the insert. Note that here we define the ‘part’ as the entire region between the flanking attL4 and attR1 sites. 5’ _attL4 site_--------Insert--------_attR1_site_3’ att_L4 Recombination Site Sequence: 5’CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAG CAATGCTTTTTTATAATGCCAACTTTGTATAGAAAAGTTG 3’ att_R1 Recombination Site Sequence: 5’CCAAGTTTGTACAAAAAAGTTGAACGAGAAACGTAAAATGATATAAATATCAATATA TTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATGCA GTCACTATG 3’


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal XbaI site found at 173
    Illegal PstI site found at 180
  • 12
    INCOMPATIBLE WITH RFC[12]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal NheI site found at 2199
    Illegal NheI site found at 2465
    Illegal PstI site found at 180
    Illegal NotI site found at 187
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
  • 23
    INCOMPATIBLE WITH RFC[23]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal XbaI site found at 173
    Illegal PstI site found at 180
  • 25
    INCOMPATIBLE WITH RFC[25]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal XbaI site found at 173
    Illegal PstI site found at 180
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal SapI.rc site found at 2076