Difference between revisions of "Part:BBa K346002:Design"
| Line 10: | Line 10: | ||
| − | [[Image:PmerT.jpg]] | + | [[Image:PmerT.jpg|center]] |
| Line 19: | Line 19: | ||
By annealing PmerT-forward (5’-3’) and PmerT-reverse (5’-3’) primers, Ptpcad carrying a sticky end of EcoRI and SpeI was cloned upstream of BBa_E0840, a GFP generator. With exogenous expression of MerR in bacteria, GFP’s expression could be induced by Hg (II) in a dose response manner(Fig.4). | By annealing PmerT-forward (5’-3’) and PmerT-reverse (5’-3’) primers, Ptpcad carrying a sticky end of EcoRI and SpeI was cloned upstream of BBa_E0840, a GFP generator. With exogenous expression of MerR in bacteria, GFP’s expression could be induced by Hg (II) in a dose response manner(Fig.4). | ||
| − | [[Image:pc-merR-PmerT.jpg]] | + | [[Image:pc-merR-PmerT.jpg|center]] |
'''Fig.4. The construction of bioreporter.''' This biosensor construct was made by fusing PmerT and a reporting system, ''gfp'', along with a plasmid structure that constitutive promoters prefixed before merR coding sequence. | '''Fig.4. The construction of bioreporter.''' This biosensor construct was made by fusing PmerT and a reporting system, ''gfp'', along with a plasmid structure that constitutive promoters prefixed before merR coding sequence. | ||
Revision as of 13:18, 27 October 2010
PmerT promoter (mercury-responsive)
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
In our design, merR was isolated from the operon and assembled with constitutive promoters of certain strength to maintain its expression intensity at certain level. For the same reason, the divergent promoter Pr was also removed by deletion of its -35 region(Fig.3).
Fig.3. DNA sequence of the Tn21 mer operator promoter region. The MerR binding site on PmerT is marked by a box. The -35 and -10 regions for both PmerR and PmerTPAD are marked with boxes, and the dyad symmetrical DNA sequence that MerR recognizes and binds to is marked with arrows under the DNA sequence. (A) The divergently oriented promoters are marked by blue box and purple box, respectively. (B) In our project, the expression intensity of MerR should be maintained exogenously, so the divergent promoter Pr (of MerR transcript) was also removed by deletion of its -35 region. The resulted promoter sequence is marked with a dark purple box Modified from (Hobman, Wilkie et al. 2005)
By annealing PmerT-forward (5’-3’) and PmerT-reverse (5’-3’) primers, Ptpcad carrying a sticky end of EcoRI and SpeI was cloned upstream of BBa_E0840, a GFP generator. With exogenous expression of MerR in bacteria, GFP’s expression could be induced by Hg (II) in a dose response manner(Fig.4).
Fig.4. The construction of bioreporter. This biosensor construct was made by fusing PmerT and a reporting system, gfp, along with a plasmid structure that constitutive promoters prefixed before merR coding sequence.
Source
PmerT is a promoter from Tn21 mercury resistance (mer) operon. By annealing PmerT-forward (5’-3’) and PmerT-reverse (5’-3’) primers, PmerT carrying a sticky end of EcoRI and SpeI was cloned into Psb1C3. The sequence is as below.
TTCCATATCGCTTGACTCCGTACATGAGTACGGAAGTAAGGTTACGCTATCCAATCC
References
Brown, N. L., J. V. Stoyanov, et al. (2003). "The MerR family of transcriptional regulators." FEMS Microbiol Rev 27(2-3): 145-163.
Hobman, J. L., J. Wilkie, et al. (2005). "A design for life: prokaryotic metal-binding MerR family regulators." Biometals 18(4): 429-436.
Liebert, C. A., R. M. Hall, et al. (1999). "Transposon Tn21, flagship of the floating genome." Microbiol Mol Biol Rev 63(3): 507-522.
Nakaya, R., A. Nakamura, et al. (1960). "Resistance transfer agents in Shigella." Biochem Biophys Res Commun 3: 654-659.
Park, S. J., J. Wireman, et al. (1992). "Genetic analysis of the Tn21 mer operator-promoter." J Bacteriol 174(7): 2160-2171.