Difference between revisions of "Part:BBa K346000:Design"

Revision as of 04:40, 25 October 2010

RBS(B0032)+T3 DNA-directed RNA polymerase T3 polymerase can drive expression of different T3 promoters in T3 phage. Since during different time the phage need different expression level of regulatory genes, there should be T3 promoters of different level. Therefore we designed to use T3 polymerase and T3 promoter to regulate the expression level of downstream gene. In our experiment, we constructed 14 different promoters by primer annealing and with standard digestion to put it into standard plasmid.Then we put GFP under T3 promoter's regulation to function as a reporter. By transforming another plasmid containing T7 promoter+rbs+T3 polymerase, we were able to calculate and compare the expression level of different promoters. The result shows that under IPTG induction, different promoters really have different expression kinetics. We put them in order of their expression level and find that phi9 T3 promoter has a medium expression level, and its expression is more robust.

Source

Enterobacteria phage T3 (Bacteriophage T3).

We used the following primers to standardize this part: T3pol_For: ccg gaattc gcggccgc t tctag ATGAACATCATCGAAAACATCGAA T3pol_Rev: aaa ctgcag cggccgc t actagt a TTATGCAAAGGCAAAGTCAGAC

References