Difference between revisions of "Part:BBa K358019:Experience"

(Applications of BBa_K358019)
(Applications of BBa_K358019)
Line 34: Line 34:
  
 
Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca
 
Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca
 +
 +
To avoid the mutation, we finally decided the cultural temperature at 30C.
  
 
===User Reviews===
 
===User Reviews===

Revision as of 22:21, 19 October 2010

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K358019

Using this part, we checked the function of SRRz gene.

Firstly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX. It is necessary to repress the lactose promoter and avoid the disadvantage of cell lysis.

Secondly, we cultured samples on M9-Km 30C/overnight.


Experiment 1:

Then, diluted the sample and added IPTG as the inducer. We measured A550 at each time.


Experiment 2:

We added IPTG, not dilute the sample. We measured A550 at each time.


Finally,


Culture condition:

We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end. We done the sequencing on this sample.


BBa_R0011: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca

Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca

To avoid the mutation, we finally decided the cultural temperature at 30C.

User Reviews

UNIQa5c742fc05955dab-partinfo-00000000-QINU UNIQa5c742fc05955dab-partinfo-00000001-QINU