Difference between revisions of "Part:BBa E1010:Experience"
Karpadillo (Talk | contribs) |
(→User Reviews) |
||
Line 27: | Line 27: | ||
|width='60%' valign='top'| | |width='60%' valign='top'| | ||
This review comes from the old result system and indicates that this part did not work in some test. | This review comes from the old result system and indicates that this part did not work in some test. | ||
+ | |} | ||
+ | {|width='80%' style='border:1px solid gray' | ||
+ | |- | ||
+ | |width='10%'| | ||
+ | <partinfo>BBa_E1010 AddReview number</partinfo> | ||
+ | <I>Nkessler</I> | ||
+ | |width='60%' valign='top'| | ||
+ | We successfully used this part for a read out system, ''e.g.'' in <partinfo>K389016</partinfo>. Additionally we compared it with a luciferase: <partinfo>K389004</partinfo>. | ||
|} | |} | ||
<!-- DON'T DELETE --><partinfo>BBa_E1010 EndReviews</partinfo> | <!-- DON'T DELETE --><partinfo>BBa_E1010 EndReviews</partinfo> |
Revision as of 19:26, 27 October 2010
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
RANDOM SEQUENCE FOUND WITHIN PART
CGCTGATAGTGCTAGTGTAGATCGC is found after the RFP stop codon and before the BioBricks suffix. Should not affect transcription or translation of RFP, but good to keep note of it especially in analyzing sequencing results. (KP of siGEM)
Applications of BBa_E1010
User Reviews
UNIQ2c3c356d66cf93fe-partinfo-00000000-QINU
Antiquity |
This review comes from the old result system and indicates that this part did not work in some test. |
No review score entered. Nkessler |
We successfully used this part for a read out system, e.g. in BBa_K389016. Additionally we compared it with a luciferase: BBa_K389004. |
UNIQ2c3c356d66cf93fe-partinfo-00000005-QINU