Difference between revisions of "Part:BBa J70565:Design"
(→Design Notes) |
(→Design Notes) |
||
Line 9: | Line 9: | ||
Additionally, a missence mutation occurred during amplification of K216008, in which nucleotide 1393 and 1394 (numbers refer to part BBaJ70565's sequence) were switched causing the sequence to read cctgtcc'''gc'''ata instead of cctgtcc'''cg'''ata. This mutation caused a single Alanine to be changed to an Arginine, which shouldn't be too much of a problem. | Additionally, a missence mutation occurred during amplification of K216008, in which nucleotide 1393 and 1394 (numbers refer to part BBaJ70565's sequence) were switched causing the sequence to read cctgtcc'''gc'''ata instead of cctgtcc'''cg'''ata. This mutation caused a single Alanine to be changed to an Arginine, which shouldn't be too much of a problem. | ||
+ | |||
+ | |||
+ | Primers for insertion of the linker region: | ||
+ | accagacccaccaccacctgaacctcctcctaatagcgaacgttgtttttc,LuxA-R | ||
+ | ggt tca ggt ggt ggt ggg tct ggt gga gga tcg aaatttggattgttcttcc,LuxB-F | ||
+ | |||
+ | Primer for correction of the missing SpeI site: | ||
+ | cgtactgcagcggccgctactagta ttattaggtatattccatgtggtacttc,LuxB-R | ||
===Source=== | ===Source=== |
Revision as of 20:34, 30 March 2010
luxAB Fusion gene, Xenorhabdus luminescens
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 530
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 1049
Design Notes
A 10 amino Gly-Ser linker was chosen to maintain functionality of the dimer, but this was fairly arbitrary and the length of the intervening linker may need to be changed.
Additionally, a missence mutation occurred during amplification of K216008, in which nucleotide 1393 and 1394 (numbers refer to part BBaJ70565's sequence) were switched causing the sequence to read cctgtccgcata instead of cctgtcccgata. This mutation caused a single Alanine to be changed to an Arginine, which shouldn't be too much of a problem.
Primers for insertion of the linker region:
accagacccaccaccacctgaacctcctcctaatagcgaacgttgtttttc,LuxA-R ggt tca ggt ggt ggt ggg tct ggt gga gga tcg aaatttggattgttcttcc,LuxB-F
Primer for correction of the missing SpeI site:
cgtactgcagcggccgctactagta ttattaggtatattccatgtggtacttc,LuxB-R
Source
Amplified from part K216008.