Difference between revisions of "Part:BBa K208002"

Revision as of 17:14, 14 October 2019

Gene III Signal Peptide - Silver Fusion Compatible

This is a Silver-fusion compatible BioBrick part that can be attached to other proteins to target those proteins for export out of the cytoplasm. The GeneIII sequence targets unfolded proteins to the Sec-dependent pathway of Type II secretion.

Usage and Biology

Signal peptides consist of about 15-30 amino acids and are generally required to direct a secretory protein to the translocons of the cytoplasmic membrane (Pugsley, 1993; Choi, 2004; Luirink, 2004). Despite overall sequence variability, structural similarities exist between different signal peptides, including a positively-charged 2-10 amino acid N-region, a hydrophobic core H-region, and a neutral C-domain of about 6 residues (Pugsley, 1993; Molhoj, 2004). The C-domain conforms to the -3, -1 rule in which amino acids with short and neutral side-chains, such as alanine, are required in positions -3 and -1 of the sequence (Choi, 2004; von Heijne, 1986). A signal peptidase interacts with a cleavage recognition site within the C-domain to release the protein into the periplasmic space (Luiritz, 2004; Choi, 2004). Once in the periplasm, secretion into the extracellular media can occur via the action of a secreton, or by chemical or enzymatic methods.

In the Sec pathway, SecA is attached peripherally to the inner membrane and drives peptide translocation through ATPase activity (van der Does, 2004). Integral membrane proteins SecY and SecE form the core of the Sec translocon, and SecG interacts with this core to form a multimeric protein complex, SecYEG (Veenendaal, 2004). This complex functions as a protein-conducting channel for both post-translational and co-translational protein export (Luirink, 2004; Veenendaal, 2004). Interestingly, the SecYEG translocon can be found in all domains of life, reiterating the prevalence and importance of this mechanism for protein export (Cao, 2002).

Characterization by BSC_United(2019)

Promoters and Their Primers

Several promoters with high expression level that are commonly used in Bacillus subtilis were screened to determine the most efficient ones for our experiments on the construction of biological parts. Three of such promoters, Groe (BBa J100034), SecA (BBa K1469002), P43 (K208002 BBa K208002]), exist in the iGEM registry already.Here we only show the data of P43(BBa_K208002).

The primer sequences for individual promoters used for our synthetic biology project are as follows:

P43-up CGCGGATCCTGATAGGTGGTATGTTTTCG

P43-down CGGGGTACCTATAATGGTACCGCTATCACT

Strains and Plasmids

The bacterium strain we used was B. subtilis WB600, and the plasmid was WB0911H-ASN (with the antibiotic ampicillin and kanamycin resistance cassette). Both the strain and plasmid were kindly donated to us by Professor Jian CHEN at Jiannan University, China.

[HERE SHOULD BE A FIGURE]

Figure 1. pMAA0911H-ASN transformation vector

The promoters Groe (BBa J100034), SecA (BBa K1469002), and P43 (BBa K208002) were used to replace the original promoter hpall in WB0911H-ASN respectively. Here ASN stands for L-asparaginase (EC.3.5.1.1). By the comparison of the ASN activity expressed in the transformants, we found that the p43 promoter was the strongest promoter. Therefore, it was selected for our project.

The promoters Groe (BBa J100034), SecA (BBa K1469002), and P43 (BBa K208002) were used to replace the original promoter hpall in WB0911H-ASN respectively. Here ASN stands for L-asparaginase (EC.3.5.1.1). By the comparison of the ASN activity expressed in the transformants, we found that the p43 promoter was the strongest promoter. Therefore, it was selected for our project.

Experiment Method

1. PCR amplification of ASN gene product
2. Construction of transformation vectors (extraction of plasmids, digestion, conjugation and transformation, etc.)
3. Construction of Bacillus subtilis transformants
4. SDS-PAGE electrophoresis to confirm the ASN protein expression#The enzymatic activity of ASN was determined by colorimetric method. The detection process was divided into two steps: hydrolysis and coloration of ASN.
5. The enzymatic activity of ASN was determined by colorimetric method. The detection process was divided into two steps: hydrolysis and coloration of ASN.
   • ASN hydrolysis: 100 ml diluted solution with ASN was added to the 1100 ml mixture of substrate and buffer. The reaction lasted for 10 min at 37°C. It was terminated by adding 100 ml of trichloroacetic acid (1.5 M). The mixture was then centrifuged at 12000 rpm for 2 minutes. The final system consisted of 900μL KH2PO4-K2HPO4 buffer (20 mM, pH 7.5) and 200 μl L-asparagine (189 mM).
   • Coloration: 100ml solution from ASN hydrolysis process was added to 3400μl deionized water, and 500μl Nessler's reagent was added for coloration, the absorbance value was detected at 436 nm. (Here the definition of ASN Enzyme Activity Unit is: The amount of enzymes required to hydrolyze L-asparagine to release 1μM NH3 in 1 minute at 37°C.
     

[HERE SHOULD BE A FIGURE]

Figure 2. Gel Electrophoresis

ASN enzymatic activities with different transformants：

[HERE SHOULD BE A FIGURE]

Figure 3. ANS enzymatic activity vs strain

Conclusion

SDS-PAGE electrophoresis (Figure 2) and the ASN enzymatic activity comparison (Figure 3) show that the ASN production may be enhanced by the replacement of promoters. and among the promoters we have characterized, P43 has the highest start-up strength (the higher the enzyme activity, the thicker and brighter the corresponding band.

We have thus characterized the basic biobricks Groe (BBa J100034), SecA (BBa K1469002) and P43 (BBa K208002)

SDS-PAGE electrophoresis results: (band for the ASN protein at 43kDa is highlighted in red color) Column M is the marker, column 1, 2, 3, 4, 5 and 6 are for the Bacillus subtilis constructs with the plasmids of WB0911H-ASN(original plasmid)、WBGroE、WBYxiE、WBSecA、WBYlbP and WB43, respectively.

Sequence and Features