fgRNA Entry Vector MbCas12a-SpCas9

This part integrates the crRNA of MbCas12a (BBa_K5237206) and the sgRNA of SpCas9 (BBa_K5237209) into a single fusion guide RNA (fgRNA). The fgRNA is functional, meaning that the MbCas12a (BBa_K5237001), SpCas9 (BBa_K5237002) and the fusion dCas (BBa_K5237003) can both utilize the fgRNA to target two different loci simultaneously. The fgRNA also works in combination with the catalyitcally inactive dCas9 and dCas12a versions. We successfully showed genome editing at two different loci simultaneously using active SpCas9 and Cas12a and induced proximity of two genomic loci with the catalytically inactive dSpCas9 and dMbCas12a.
For our part collection, the PICasSO toolbox, this part is the central key, since it enables to the formation of our CRISPR/Cas staples - trimeric complexes comprised of a fgRNA, dCas9 and dCas12a employed for tethering two distinct genomic loci for 3D genome engineering.

Figure 1: How our part collection can be used to engineer new staples

While synthetic biology has in the past focused on engineering the genomic sequence of organisms, the 3D spatial organization of DNA is well-known to be an important layer of information encoding in particular in eukaryotes, playing a crucial role in gene regulation and hence cell fate, disease development, evolution and more. However, tools to precisely manipulate and control the genomic spatial architecture are limited, hampering the exploration of 3D genome engineering in synthetic biology. We - the iGEM Team Heidelberg 2024 - have developed PICasSO, a powerful molecular toolbox for rationally engineering genome 3D architectures in living cells, based on various DNA-binding proteins.

The PICasSO part collection offers a comprehensive, modular platform for precise manipulation and re-programming of DNA-DNA interactions using engineeered "protein staples" in living cells. This enables researchers to recreate naturally occuring alterations of 3D genomic interactions, such as enhancer hijacking in cancer, or to design entirely new spatial architectures for artifical gene regulation and cell function control. Specifically, the fusion of two DNA binding proteins enables to artifically bring otherwise distant genomic loci into spatial proximty. To unlock the system's full potential, we introduce versatile chimeric CRISPR/Cas complexes, connected either at the protein or - in case of CRISPR-Cas-based DNA binding moieties - the guide RNA level. These complexes are reffered to as protein- or Cas staples, respectively. Beyond its versatility with regard to the staple constructs themselves, PICasSO includes robust assay systems to support the engineering, optimization, and testing of new staples in vitro and in vivo. Notably, the PICasSO toolbox was developed in an design-build-test-learn engineering cycle closely intertwining wet-lab experiments and computational modeling and iterated several times, yielding a collection of well-functioning and -characterized parts.

At its heart, the PICasSO part collection consists of three categories.
(i) Our DNA-binding proteins include our finalized Cas staple experimentally validated using an artificial "enhancer hijacking" system as well as "half staples" that can be combined by scientists to compose entirely new Cas staples in the future. We also include our Simple staples comprised of particularly small, simple and robust DNA bindig domains well-known to the synthetic biology community, which serve as controls for successful stapling and can be further engineered to create alternative, simpler and more compact staples.
(ii) As functional elements, we list additional parts that enhance and expand the functionality of our Cas and Basic staples. These consist of staples dependent on cleavable peptide linkers targeted by cancer-specific proteases or inteins that allow condition-specific, dynamic stapling in vivo. We also include several engineered parts that enable the efficient delivery of PICasSO's constructs into target cells, including mammalian cells, with our new interkingdom conjugation system.
(iii) As the final category of our collection, we provide parts that underlie our custom readout systems. These include components of our established FRET-based proximity assay system, enabling users to confirm accurate stapling. Additionally, we offer a complementary, application-oriented testing system based on a luciferase reporter, which allows for straightforward experimental assessment of functional enhancer hijacking events in mammalian cells.

The following table gives a comprehensive overview of all parts in our PICasSO toolbox. The highlighted parts showed exceptional performance as described on our iGEM wiki and can serve as a reference. The other parts in the collection are versatile building blocks designed to provide future iGEMers with the flexibility to engineer their own custom Cas staples, enabling further optimization and innovation in the new field of 3D genome engineering.

Our part collection includes:

1. Sequence overview

2. Usage and Biology

2.1 Discovery and Mechanism of CRISPR/Cas9

Figure 2: The CRISPR/Cas system A and B, schematic structure of Cas9 and Cas12a with their sgRNA/crRNA, sitting on a DNA strand with their respective PAMs. The sgRNA/crRNA spacer sequence binds the DNA target strand via complementary base pairing. In case of Cas9 the spacer is located at the 5' prime end, for Cas12a at the 3' end of the gRNA. The scaffold of the gRNA forms a specific secondary structure enabling it to be bound by the Cas protein. DNA cleavage sites are indicated by the scissors.

In 2012, Jinek et al. discovered the use of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas system to induce double-strand breaks in DNA. Since then, the system has been well established as a tool for genome editing. The CRISPR/Cas system, which originates from the bacterial immune system, is constituted by a ribonucleoprotein complex. For class 1 CRISPR systems, an RNA guide is complexed by multiple Cas proteins, whereas class 2 systems consist of a singular protein binding RNA. The class 2 type II system describes all ribonucleoprotein complexes with Cas9 (Pacesa et al., 2024). They include a CRISPR RNA (crRNA), which specifies the target sequence with a ~20 nucleotide (nt) spacer sequence, and a transactivating CRISPR RNA (tracrRNA), which induces the processing by the Cas protein (Jinek et al., 2012) (Fig. 2 A). Furthermore, a specific three nucleotide sequence (NGG) at the 3' end in the targeted DNA is needed for Cas9 DNA binding and cleavage. This is referred to as the protospacer adjacent motif (PAM) (Sternberg et al., 2014). The most commonly used Cas9 protein is SpCas9 or SpyCas9, which originates from Streptococcus pyogenes (Pacesa et al., 2024).

A significant enhancement of the CRISPR-Cas9 system was the introduction of single guide RNAs (sgRNA[s]), which combine the functions of a tracrRNA and crRNA (Jinek et al., 2012; Mali et al., 2013). Moreover, Cong et al. (2013) established precise targeting of human endogenous loci by designing the 20 nt spacer sequence accordingly.

3. Assembly and part evolution

Building on insights of our fusion Cas engineering cycle and findings from Kweon (2017), fgRNAs were designed by combining the sgRNA from SpCas9 with the crRNA from MbCas12a. Specifically the 3'-end of the MbCas12a gRNA was linked to the 5'-end of the SpCas9 gRNA (through genetic fusion). Via this approach, the two spacer sequences are fused directly, ensuring a minimal distance between the two DNA strands to be co-bound by the Cas staple complex.This also facilitates efficient cloning of different spacer sequences, as both spacers can be obtained as one consecutive sequence encoded on a single oligo. Linking the crRNA and sgRNA further enables multiplexing, as Cas12a can inherently process crRNA repeats that are expressed from one single transcript, enabling multiplexing. The entry vector includes a U6 promoter, the MbCas12a scaffold, a bacterial promoter driving ccdB expression, and the SpCas9 scaffold. Successful spacer integration leads to the removal of the ccdB gene, allowing bacterial growth to be used as an indicator for cloning success.
A conventional gRNA expression vector containing an MbCas12a crRNA scoffold under the control of an U6 promoter was selected as the basis for entry vector cloning. The vector and a ccdB-SpCas9 scaffold construct were PCR amplified and fitting overhangs for SapI were introduced (Fig. 3). Golden Gate assembly (GGA) with Esp3I was used to create the final plasmid. The transformation was carried out in the ccdB-resistant XL1 Blue E. Coli strain.

Figure 3: Construction process of fgRNAs using the entry vector. The ccdB gene excised using SapI in a Golden Gate assembly. By inserting oligonucleotides with the desired spacer sequences and matching overhangs, the complete fgRNA can be assembled into the entry vector. Due to the cytotoxic nature of ccdB, only cells with the oligonucleotides as inserts survive.

The first goal following successful assembly of our first fgRNAs was to show the simultaneous editing of the two fgRNA-targeted genomic sites in mammalian cells (HEK239T). The genes VEGFA and FANCF were selected as targets for Cas12a and Cas9 and each target was tested with each Cas protein using corresponding fgRNA designs. Editing efficiency was analyzed with the T7 Endonuclease I (T7EI) assay widely used in the CRISPR field. Controls included the use of conventional crRNAs and sgRNAs with their cognate Cas effectors as positive controls, and non-targeting guides as negative controls. Desired spacer sequences were ordered as synthetic oligos, annealed, and cloned in via GGA utilizing SapI.

Figure 4: Applications of the Fusion Guide RNA Fusion Guide RNAs can be used for multiplex genome editing by guidingactive Cas12a and Cas9 to two distinct loci. Similarly, fgRNAs allow for CRISPRa, by guiding the Cas9-VP64 transcriptional activator towards a target locus.

We constructed a second entry vector incorporating an AsCas12a scaffold (5' taatttctactcttgtagat 3') instead of MbCas12a. The sequence of the AsCas12a scaffold was the only modification in the composite part. This vector was tested on the loci VEGFA and FANCF to assess its functionality.

4. Results

4.1 Editing endogenous loci with fgRNAs

To prove that our fusion gRNAs still result in active ribonucleoproteins, a series of different fgRNAs were created, each carrying spacers specific to the VEGFA and FANCF genes.HEK293-T cells were transfected with the Cas protein and gRNA constructs. The editing rate was tested 72h after transfection via a T7 endonuclease I assay.
AsCas12a and SpCas9 were used. The AsCas12a spacer targets VEGFA, while the SpCas9 spacer targets FANCF. The samples included standard single gRNAs with the corresponding Cas protein, the fgRNA with only one of the two Cas proteins and the fgRNA with both Cas proteins simultaneously (Fig. 5). The sgRNAs allowed for the highest editing rates for both genes (45% for VEGFA and 15% for FANCF), while the editing rates for FANCF were consistently lower in all experiments. Importantly, targeting FANCF with fgRNAs resulted in noticeable editing of about 10%, with just the SpCas9 and both Cas proteins in the sample. For VEGFA, the AsCas12a only sample resulted in approximately 20% editing rate in combination with the fgRNA, while adding both Cas proteins led to approximately 40%. These initial results confirmed our engineering approach proving efficient genome editing with fgRNAs.

Figure 5: fgRNAs Enable Efficient Editing of Endogenous Loci. The editing rates were determined 72h after transfection via T7EI assay. Editing % was determined by measuring band intensities; Editing % = 100 x (1 - (1- cleaved band/uncleaved band))^1/2. The schematic at the top shows the composition of the fgRNA. Below each spacer is the targeted gene. The symbols below indicate which parts are included in each sample.

4.2 Efficient Fusion Guide RNA-Mediated Editing With Various Cas Orthologs

After showing efficient editing, the next step was to evaluate the capabilities of the fgRNAs, we tested them in combination with different Cas12a orthologs. After some initial testing, we decided on using MbCas12a together with SpCas9, because we found AsCas12a to be less active in a dual luciferase assay when co-transfected with SpCas9 compared to MbCas12a (Fig. 6). Between these two co-transfections the SpCas9 editing has not been significantly different.

Figure 6: Comparison of AsCas12a and MbCas12a with a dual luciferase assay. Firefly luminescence intensity measured 48 h after transfection. Normalized against renilla luminescence. On the x-axis the samples Cas9 + AsCas12a , Cas9 + MbCas12a, AsCas12a and MbCas12a are depicted. Data is depicted as the mean +/- SD (n=3). Statistical analysis was performed using 1way ANOVA with Tukey's multiple comparisons test. For better clarity, only significant differences within a group between the same Cas proteins are shown.*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001

Additionally, to test if the differences in editing rates from the preliminary assay resulted from the targeted loci or the different Cas orthologs, the spacers were tested in both arrangements. Once with Cas12a targeting FANCF and SpCas9 targeting VEGFA and once vice versa. To better assess the impact that the utilization of a fgRNA has on the editing rates, the sgRNAs were tested separately and in one sample.
Having the sgRNA with single Cas proteins in the same sample resulted in no clear difference in the editing rates (Fig. 7). The fusion of the gRNAs resulted in a lower editing rate overall. While the editing for VEGFA stayed at about 20% in all cases, the editing for FANCF dropped significantly. When targeting the same gene under the same conditions, the editing rates for MbCas12a were overall lower than the ones from SpCas9.

Figure 7: Fusion gRNA Editing Rates In Combination with MbCas12a. In A and B the editing rates were determined 72h after transfection via T7EI assay. Editing % was determined by measuring band intensities; Editing % = 100 x (1 - (1- cleaved band/uncleaved band) ^1/2). The schematic at the top shows the composition of the fgRNA. Below each spacer is the targeted gene. The symbols below indicate which parts are included in each sample. A and B display both orientations of the two spacers for VEGFA and FANCF.

4.3 The Inclusion of a Linker Does Not Lower Editing Rates

To further assess the effect of the genomic locus on the editing rate, we included CCR5 as an additional gene target. For this assay, a fgRNA with a 20 nt long linker was included between the two spacers. The editing rate for VEGFA was again relatively consistent throughout the samples (Fig. 8). For CCR5, the editing rate with sgRNAs was approximately the same at about 30%. However, it dropped below 10% for the fgRNA. The addition of the 20 nt linker had no effect on the editing rates compared to no linker.

Figure 8: Fusion gRNA Editing Rates for Multiplexing CCR5 and VEGFA The editing rates were determined 72h after transfection via T7EI assay. Editing % was determined by measuring band intensities; Editing % = 100 x (1 - (1- cleaved band/uncleaved band))^1/2. The schematic at the top shows the composition of the fgRNA. Below each spacer is the targeted gene. The symbols below indicate which parts are included in each sample. Cas12a targets VEGFA and Cas9 targets CCR5.

4.4 fgRNAs can be used for CRISPRa

To establish the foundation for their use as protein scaffolds, we identified the next step as demonstrating the use of fgRNAs for CRISPR activation. For this, we intend to recruit the transcriptional activator VP64 to a firefly luciferase gene to induce expression. The VP64 protein is attached to the catalytically inactive Cas9 protein, which is then guided by gRNAs to the luciferase gene. The gRNAs target a TetO sequence, which is positioned in front of the luciferase gene in multiple repeats. The firefly luciferase activity was then quantified as photon counts and normalized against Renilla luciferase, which is expressed on a separate plasmid under an ubiquitous promoter. In two biological replicates we saw similar Relative luciferase activity with fgRNA as a guide compared to a sgRNA (Fig. 9).

Figure 9: CRISPRa Induced Luciferase Expression for sgRNAs and fgRNAs. Firefly luciferase activity was measured 48h after transfection. Normalized against ubiquitously expressed Renilla luciferase. The tetO repeats were targeted by Cas9-VP64, once with a sgRNA and once with a fgRNA that had a non-targeting sequence for the Cas12a spacer. The schematic at the top shows the composition of the fgRNA. Below each spacer is the targeted gene. The symbols below indicate which parts are included in each sample.

4.5 Stapling Two DNA Strands Together Using fgRNAs

After showing the general capability of the fgRNA to work for editing and for CRISPR activation, the next step was to use it to staple two DNA loci together, and thereby induce proximity between two separate functional elements. For this, an enhancer plasmid and a reporter plasmid was used. The reporter plasmid has firefly luciferase behind several repeats of a Cas9 targeted sequence. The enhancer plasmid has a Gal4 binding site behind several repeats of a Cas12a targeted sequence. By introducing a fgRNA staple and a Gal4-VP64, expression of the luciferase is induced (Fig. 10, Panel A). Different linker lengths were tested. Cells were again normalized against ubiquitous renilla expression.
Using no linker between the two spacers showed similar relative luciferase activity to the baseline control (Fig. 10, Panel B). An extension of the linker from 20 nt up to 40 nt resulted in an increasingly higher expression of the reporter gene. These results suggest an extension of the linker might lead to better transactivation when hijacking an enhancer/activator.

Figure 10: Applying Fusion Guide RNAs for Cas staples. A, schematic overview of the assay. An enhancer plasmid and a reporter plasmid are brought into proximity by a fgRNA Cas staple complex binding both plasmids. Target sequences were included in multiple repeats prior to the functional elements. Firefly luciferase serves as the reporter gene, the enhancer is constituted by multiple Gal4 repeats that are bound by a Gal4-VP64 fusion. B, results of using a fgRNA Cas staple for trans activation of firefly luciferase. Firefly luciferase activity was measured 48h after transfection. Normalized against ubiquitously expressed Renilla luciferase. Statistical significance was calculated with ordinary One-way ANOVA with Dunn's method for multiple comparisons (*p < 0.05; **p < 0.01; ***p < 0.001; mean +/- SD). The assay included sgRNAs and fgRNAs with linker lengths from 0 nt to 40 nt.

5. References

Aregger, M., Xing, K., & Gonatopoulos-Pournatzis, T. (2021). Application of CHyMErA Cas9-Cas12a combinatorial genome-editing platform for genetic interaction mapping and gene fragment deletion screening. Nature Protocols, 16, 4722-4765. https://doi.org/10.1038/s41596-021-00595-1

Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., & Zhang, F. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819-823. https://doi.org/10.1126/science.1231143

Gonatopoulos-Pournatzis, T., Aregger, M., Brown, K. R., Farhangmehr, S., Braunschweig, U., Ward, H. N., Ha, K. C. H., Weiss, A., Billmann, M., Durbic, T., Myers, C. L., Blencowe, B. J., & Moffat, J. (2020). Genetic interaction mapping and exon-resolution functional genomics with a hybrid Cas9-Cas12a platform. Nature Biotechnology, 38, 638-648. https://doi.org/10.1038/s41587-020-0437-z

Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816-821. https://doi.org/10.1126/science.1225829

Kampmann, M. (2017). CRISPRi and CRISPRa screens in mammalian cells for precision biology and medicine. ACS Chemical Biology, 13, 406-416. https://doi.org/10.1021/acschembio.7b00657

Kleinstiver, B. P., Sousa, A. A., Walton, R. T., Tak, Y. E., Hsu, J. Y., Clement, K., Welch, M. M., Horng, J. E., Malagon-Lopez, J., Scarfò, I., Maus, M. V., Pinello, L., Aryee, M. J., & Joung, J. K. (2019). Engineered CRISPR-Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing. Nature Biotechnology, 37, 276-282. https://doi.org/10.1038/s41587-018-0011-0

Koonin, E. V., Gootenberg, J. S., & Abudayyeh, O. O. (2023). Discovery of diverse CRISPR-Cas systems and expansion of the genome engineering toolbox. Biochemistry, 62, 3465-3487. https://doi.org/10.1021/acs.biochem.3c00159

Kweon, J., Jang, A.-H., Kim, D.-e., Yang, J. W., Yoon, M., Rim Shin, H., Kim, J.-S., & Kim, Y. (2017). Fusion guide RNAs for orthogonal gene manipulation with Cas9 and Cpf1. Nature Communications, 8. https://doi.org/10.1038/s41467-017-01650-w

Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-guided human genome engineering via Cas9. Science, 339, 823-826. https://doi.org/10.1126/science.1232033

Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., Zhang, F., & Nureki, O. (2014). Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell, 156, 935-949. https://doi.org/10.1016/j.cell.2014.02.001

Pacesa, M., Pelea, O., & Jinek, M. (2024). Past, present, and future of CRISPR genome editing technologies. Cell, 187, 1076-1100. https://doi.org/10.1016/j.cell.2024.01.042

Paul, B., & Montoya, G. (2020). CRISPR-Cas12a: Functional overview and applications. Biomedical Journal, 43, 8-17. https://doi.org/10.1016/j.bj.2019.10.005

Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C., & Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature, 507, 62-67. https://doi.org/10.1038/nature13011

Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., van der Oost, J., Regev, A., Koonin, E. V., & Zhang, F. (2015). Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 163, 759-771. https://doi.org/10.1016/j.cell.2015.09.038