Difference between revisions of "Part:BBa K5201001"

(→‎Characterisation of BBa_K5201001: HongKong-UCCKE)
(→‎Characterisation of BBa_K5201001: HongKong-UCCKE)
Line 34: Line 34:
 
</head>
 
</head>
 
<body>
 
<body>
−
<table>
+
       <p><b>Biology</b> </p>
−
  <tr>
+
−
    <td>
+
−
       <p>Part registry </p>
+
−
    </td>
+
−
    <td>
+
−
      <p>BBa_K5201001</p>
+
−
    </td>
+
−
  </tr>
+
−
  <tr>
+
−
    <td>
+
−
      <p>Part type </p>
+
−
    </td>
+
−
    <td>
+
−
      <p>Coding sequence </p>
+
−
    </td>
+
−
  </tr>
+
−
  <tr>
+
−
    <td>
+
−
      <p>Short description </p>
+
−
    </td>
+
−
    <td>
+
−
      <p><i>kfiD </i>is a gene originated from <i>E. coli K5 strain, </i>codons are optimized for overexpression of UDP-glucose-6-dehydrogenase (UGDH) in <i>E. coli</i></p>
+
−
    </td>
+
−
  </tr>
+
−
  <tr>
+
−
    <td>
+
−
      <p>Long description </p>
+
−
    </td>
+
−
    <td>
+
−
      <p>Biology </p>
+
 
       <p><i>kfiD </i>encodes UDP-glucose-6-dehydrogenase (UGDH) from <i>E. coli K5</i> strain. </p>
 
       <p><i>kfiD </i>encodes UDP-glucose-6-dehydrogenase (UGDH) from <i>E. coli K5</i> strain. </p>
 
       <br></br>
 
       <br></br>
−
       <p>Usage and design </p>
+
       <p><b>Usage and design</b> </p>
 
       <p>UGDH is endogenously expressed in a low level in <i>E. coli, </i>our recombinant plasmid will overexpress  UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of <i>kfiD </i>can increase production of Hyaluronic Acid, by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use. </p>
 
       <p>UGDH is endogenously expressed in a low level in <i>E. coli, </i>our recombinant plasmid will overexpress  UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of <i>kfiD </i>can increase production of Hyaluronic Acid, by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use. </p>
−
    </td>
 
−
  </tr>
 
−
  <tr>
 
−
    <td>
 
−
      <p>Source </p>
 
−
    </td>
 
−
    <td>
 
−
      <p><i>E. coli K5 strain </i></p>
 
−
    </td>
 
−
  </tr>
 
−
  <tr>
 
−
    <td>
 
−
      <p>Design consideration </p>
 
−
    </td>
 
−
    <td>
 
−
      <p><i>kfiD </i>is designed to optimize over-expression for <i>E. coliI</i>. This ensures a high amount of UDP-glucuronic acid, and hence, HA can be produced</p>
 
−
    </td>
 
−
  </tr>
 
−
  <tr>
 
−
    <td>
 
−
      <p>Sequence </p>
 
−
    </td>
 
−
    <td>
 
−
      <p>gaattcgcggccgcttctagagatgcatcaccatcatcaccacttcggtaccctgaagatcacggtcagcggtgcgggctacgtgggtctttccaatggcatcctcatggcccagaaccacgaagtagtggcttttgatacccaccagaaaaaagtggatttactgaacgacaaattgagcccgattgaagataaggaaatcgagaattacctgtccacaaagatcttaaactttcgcgccactaccaataagtatgaagcctacaaaaatgcaaactatgtaattatcgcgacgccgactaattatgaccccggttctaactatttcgataccagtagtgtcgaagcggtgattcgtgatgtcacggaaatcaatccgaacgcgataatggttattaagagcaccgttccggtcggattcacgaaaactattaaagaacatctgggtatcaataacattatttttagtcccgaatttctgcgtgaaggccgcgcgttatatgacaacctacatccgtcacgcatcatcattggtgagcgctctgagcgcgcggaacgtcttgcggtgttattccaggaaggcgctatcaaacaaaatattcctgttttgtttaccgactcaaccgaagcagaagccataaaactgtttagcaacacatatctggcgatgcgagttgcattcttcaacgagctggatagctacgcagaaagcttcggactgaatacacgacagatcattgatggggtatgcctggatcctcgcattggcaactactacaataaccctagctttggttatggcggctattgcctgccgaaagataccaagcagctgcttgcgaactatcagtcagtgccgaacaaacttatttcggccattgtcgatgcaaatcgcaccaggaaagatttcatcaccaatgtgattttgaagcatcgtccacaagtagtgggcgtttatcgtctgattatgaaaagtggatcggataacttccgcgactcgtcaattctgggcattatcaaacgtatcaaagaaaaaggcgtgaaagttattatatacgagccgttgatttccggggatactttttttaactctccactcgagcgtgagctggccatttttaaagggaaagccgacattattattacgaatcgcatgagcgaagaattaaatgacgttgtggataaagtgtactcgcgggacctctttaaatgtgattactagtagcggccgctgcag</p>
 
−
    </td>
 
−
  </tr>
 
−
  <tr>
 
−
    <td>
 
−
      <p>Assembly compatibility </p>
 
−
    </td>
 
−
    <td>
 
−
      <p>rfc10</p>
 
−
    </td>
 
−
  </tr>
 
−
</table>
 
−
</body>
 
−
</html>
 
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>

Revision as of 15:01, 1 October 2024

kfiD codons are optimized for overexpression of UDP-glucose-6-dehyrogenase

Biology kfiD encodes UDP-glucose-6-dehydrogenase (UGDH) from E. coli K5 strain.

Usage and design UGDH is endogenously expressed in a low level in E. coli, our recombinant plasmid will overexpress UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of kfiD can increase production of Hyaluronic Acid (HA), by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use.

Usage and Biology

Characterisation of BBa_K5201001: HongKong-UCCKE

Document

Biology

kfiD encodes UDP-glucose-6-dehydrogenase (UGDH) from E. coli K5 strain.



Usage and design

UGDH is endogenously expressed in a low level in E. coli, our recombinant plasmid will overexpress UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of kfiD can increase production of Hyaluronic Acid, by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use.

Sequence and Features BBa_K5201001 SequenceAndFeatures