Difference between revisions of "Part:BBa K5317019"
Annaseidler (Talk | contribs) (→Usage and Biology) |
Annaseidler (Talk | contribs) (→Theoretical Part Design) |
||
| Line 8: | Line 8: | ||
===Theoretical Part Design=== | ===Theoretical Part Design=== | ||
| − | Placing the ccpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K3338014]</span>)upstream of the reporter gene mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part: | + | Placing the ccpA (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K3338014 K3338014]</span>)upstream of the reporter gene mRuby2 (<span class="plainlinks">[https://parts.igem.org/Part:BBa_K5317001 K5317001]</span>) allows for visualisation of location of ccpA. |
<!-- --> | <!-- --> | ||
<span class='h3bb'> | <span class='h3bb'> | ||
Revision as of 14:10, 1 October 2024
CMV-CcpA-mRuby2
Usage and Biology
The regulatory functions of CcpA are modulated by phosphorylation by serine/threonine kinases, which can affect its DNA-binding activity and thus its ability to regulate target genes. We aim to use this mechanism to detect ß-lactams, which can bind to pknB, potentially leading to phosphorylation of ccpA, which could then bind to our specifically engineered promoter 3xCre3xAP1-miniCMV (K5317017). We therefore fused an mRuby2 marker gene (K5317001) to detect localization of ccpA protein in HEK292T cells.
Theoretical Part Design
Placing the ccpA (K3338014)upstream of the reporter gene mRuby2 (K5317001) allows for visualisation of location of ccpA.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 1669
Cloning
We linearized the mammalian expression vector pEGFP-C2 with NheI and BamHI and inserted the both genes ccpA(K33380014) and mRuby2(K3338001), which were fused bevorhand together with matching overhangs. The ccpA gene was acquired from S. aureus. Following the NEBBuilder® user protocol this vector was cloned via HIFI assembly method.This composite part was cloned by using the primers in table 1.
| Primer name | Sequence |
|---|---|
| ccpA_fw_1 | tggatccccttttgtagttcctcggtattcaattctgtgag |
| ccpA_rv_2 | TGAACCGTCAGATCCGatgacagttactatatatgatgtagcaagagaagc |
| ccpA_fw_3 | actacaaaaggggatccaccggtcg |
| ccpA_rv_4 | TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc |
Characterisation
Transfection experiments of CcpA in mammalian HEK cells to show localisation and activation of CcpA in unstimulated conditions. This is was one of three possible transcription factors we analysed within this project. However, this protein was unable to be expressed in HEK cells and was not further investigated.
Single-transfection experiments
Figure 2: Depicted HEK cells transfected with CMV-ccpA-mRuby2 containing plasmid. Scaling (bottom right) is 10 µM.
In Figure 2 are transfected CMV-ccpA-mRuby2-HEK cells shown. CcpA did show any fluorescent signal and did not lead to any further investigations.
References
Bulock, L. L., Ahn, J., Shinde, D., Pandey, S., Sarmiento, C., Thomas, V. C., Guda, C., Bayles, K. W., & Sadykov, M. R. (2022). Interplay of CodY and CcpA in Regulating Central Metabolism and Biofilm Formation in Staphylococcus aureus. Journal of Bacteriology, 204(7), e00617-21. https://doi.org/10.1128/jb.00617-21
Liao, X., Li, H., Guo, Y., Yang, F., Chen, Y., He, X., Li, H., Xia, W., Mao, Z.-W., & Sun, H. (2022). Regulation of DNA-binding activity of the Staphylococcus aureus catabolite control protein A by copper (II)-mediated oxidation. Journal of Biological Chemistry, 298(3), 101587. https://doi.org/10.1016/j.jbc.2022.101587