Difference between revisions of "Part:BBa K5508006"

 
Line 12: Line 12:
 
<partinfo>BBa_K5508006 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K5508006 SequenceAndFeatures</partinfo>
  
 +
==Result==
 +
===(1)Plasmid Construction===
 +
We amplified neuB and age fragments using neuB-Spe-F, neuB-EcoR-R and age-Xho-F , age-Hind-R respectively. The specific sequences of the primers are listed below.
 +
<html>
 +
<style>
 +
    table {
 +
        width: 100%;
 +
        border-collapse: collapse;
 +
    }
 +
 +
    table, th, td {
 +
        border: 1px solid black;
 +
    }
 +
 +
    th, td {
 +
        padding: 10px;
 +
        text-align: left;
 +
    }
 +
 +
    th {
 +
        background-color: #f2f2f2;
 +
    }
 +
</style>
 +
 +
<body>
 +
 +
<h2>Primer Sequences</h2>
 +
 +
<table>
 +
    <tr>
 +
        <th>Primer</th>
 +
        <th>Sequences (5’-3’)</th>
 +
    </tr>
 +
    <tr>
 +
        <td>neuB-Spe-F</td>
 +
        <td>GGACTAGTTCATTCACCTTGATTCTTGAACTC</td>
 +
    </tr>
 +
    <tr>
 +
        <td>neuB-EcoR-R</td>
 +
        <td>CCGGAATTCATGTCCAACATCTACATTGTTG</td>
 +
    </tr>
 +
    <tr>
 +
        <td>age-Xho-F</td>
 +
        <td>CCGGAATTCATGTCCAACATCTACATTGTTG</td>
 +
    </tr>
 +
    <tr>
 +
        <td>age-Hind-R</td>
 +
        <td>CCCAAGCTTTTAAGACAAAGCCTCAAATTGTTG</td>
 +
    </tr>
 +
</table>
 +
 +
</body>
 +
</html>
 +
 +
After electrophoretic detection, it was confirmed that both fragments were amplified successfully.
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/11.png">
 +
  <div class="unterschrift"><b> Electrophoretic detection of PCR results</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
Subsequently, we enzymatically digested the vector and neuB gene fragments with SpeI and EcoR I, respectively, and ligated them using T4 ligase before transferring them into E. coli DH5α competent cells. After screening by transferring into Amp-added LB medium, single colonies were successfully grown after 12h. Colony PCR and sequencing were used to verify whether the gene was successfully inserted into the plasmid.
 +
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/12.png">
 +
  <div class="unterschrift"><b>Results of plasmid transformation in Escherichia coli DH5α</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/13.png">
 +
  <div class="unterschrift"><b>Sequencing results</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/14.png">
 +
  <div class="unterschrift"><b>Results of colony PCR electrophoresis</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
After confirming the success of the construction, we extracted the plasmid and used it as a vector, which was digested with target genes age using Xho I and Hind III, respectively, and then ligated using T4 ligase. The subsequent steps were the same as before. The correctness of the recombinant plasmid was also determined by colony PCR and sequencing.
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/15.png">
 +
  <div class="unterschrift"><b>Results of plasmid transformation in Escherichia coli DH5α</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/16.png">
 +
  <div class="unterschrift"><b>Sequencing results</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/17.png">
 +
  <div class="unterschrift"><b>Results of colony PCR electrophoresis</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
===（2）SDS-PAGE===
 +
To test whether both enzymes are normally expressed, we performed SDS-PAGE. As shown in the figure, the bands between 30 kDa and 50 kDa were darker in colour than the negative control bands, but there was no significant increase in the bands, probably due to the lower expression.
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/18.png">
 +
  <div class="unterschrift"><b>SDS-PAGE results</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
===（3）N-acetylneuraminic acid production by colorimetric assay===
 +
The plasmid pESC-neuB-age was transferred into the Saccharomyces cerevisiae BY4741.
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/19.png">
 +
  <div class="unterschrift"><b>Results of plasmid transformation in Saccharomyces cerevisiae</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
For the detection of N-acetylneuraminic acid in the fermentation broth, a commercial kit was chosen. This kit is based on the principle that N-acetylneuraminic acid forms a purplish-red complex with 5-Methylresorcinol in the presence of an oxidising agent, and the absorbance follows the colourimetric law. The amount of N-acetylneuraminic acid can be calculated by measuring the absorbance of the complex and comparing it to a standard.
 +
 +
In order to avoid errors caused by other components in the medium, we transfected the pESC-URA plasmid into BY4741 as a negative control, which was cultured and induced in exactly the same way as the engineered bacterium pESC-neuB-age /BY4741.
 +
 +
 +
Compared to the negative control tubes, we found that the colour of the engineered bacterium pESC-neuB-age/BY4741 appeared significantly deeper and the absorbance increased. From the measurement of absorbance and calculation, we can see that after 48h fermentation, the yield of N-acetylneuraminic acid was about 0.7 g/L.
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/20.png">
 +
  <div class="unterschrift"><b>Comparison chart of N-acetylneuraminic acid assay</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5508/hangzhoumedx-parts/21.png">
 +
  <div class="unterschrift"><b>Absorbance of N-acetylneuraminic acid detection solution</b>
 +
  </div>
 +
</p>
 +
</html>
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Revision as of 20:55, 30 September 2024


ADH1-neuB-Gal1,10-age-CYC1

The Part consists of BBa_K5508003 and BBa_K5508005. The N-acetylglucosaminidase differential isomerase gene BBa_K5508004(age) is from Anabaena sp. CH1 and the N-acetylneuraminic acid synthesis gene BBa_K5508002(nueB) is from Escherichia coli K1, synthesized by Gene Synthesis. The two genes are at opposite ends of BBa_K5477005 and are under its control.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 374
    Illegal AgeI site found at 1905
    Illegal AgeI site found at 2291
  • 1000
    COMPATIBLE WITH RFC[1000]

Result

(1)Plasmid Construction

We amplified neuB and age fragments using neuB-Spe-F, neuB-EcoR-R and age-Xho-F , age-Hind-R respectively. The specific sequences of the primers are listed below.

Primer Sequences

Primer Sequences (5’-3’)
neuB-Spe-F GGACTAGTTCATTCACCTTGATTCTTGAACTC
neuB-EcoR-R CCGGAATTCATGTCCAACATCTACATTGTTG
age-Xho-F CCGGAATTCATGTCCAACATCTACATTGTTG
age-Hind-R CCCAAGCTTTTAAGACAAAGCCTCAAATTGTTG

After electrophoretic detection, it was confirmed that both fragments were amplified successfully.

Electrophoretic detection of PCR results

Subsequently, we enzymatically digested the vector and neuB gene fragments with SpeI and EcoR I, respectively, and ligated them using T4 ligase before transferring them into E. coli DH5α competent cells. After screening by transferring into Amp-added LB medium, single colonies were successfully grown after 12h. Colony PCR and sequencing were used to verify whether the gene was successfully inserted into the plasmid.

Results of plasmid transformation in Escherichia coli DH5α

Sequencing results

Results of colony PCR electrophoresis

After confirming the success of the construction, we extracted the plasmid and used it as a vector, which was digested with target genes age using Xho I and Hind III, respectively, and then ligated using T4 ligase. The subsequent steps were the same as before. The correctness of the recombinant plasmid was also determined by colony PCR and sequencing.

Results of plasmid transformation in Escherichia coli DH5α

Sequencing results

Results of colony PCR electrophoresis

（2）SDS-PAGE

To test whether both enzymes are normally expressed, we performed SDS-PAGE. As shown in the figure, the bands between 30 kDa and 50 kDa were darker in colour than the negative control bands, but there was no significant increase in the bands, probably due to the lower expression.

SDS-PAGE results

（3）N-acetylneuraminic acid production by colorimetric assay

The plasmid pESC-neuB-age was transferred into the Saccharomyces cerevisiae BY4741.

Results of plasmid transformation in Saccharomyces cerevisiae

For the detection of N-acetylneuraminic acid in the fermentation broth, a commercial kit was chosen. This kit is based on the principle that N-acetylneuraminic acid forms a purplish-red complex with 5-Methylresorcinol in the presence of an oxidising agent, and the absorbance follows the colourimetric law. The amount of N-acetylneuraminic acid can be calculated by measuring the absorbance of the complex and comparing it to a standard.

In order to avoid errors caused by other components in the medium, we transfected the pESC-URA plasmid into BY4741 as a negative control, which was cultured and induced in exactly the same way as the engineered bacterium pESC-neuB-age /BY4741.


Compared to the negative control tubes, we found that the colour of the engineered bacterium pESC-neuB-age/BY4741 appeared significantly deeper and the absorbance increased. From the measurement of absorbance and calculation, we can see that after 48h fermentation, the yield of N-acetylneuraminic acid was about 0.7 g/L.

Comparison chart of N-acetylneuraminic acid assay

Absorbance of N-acetylneuraminic acid detection solution