Difference between revisions of "Part:BBa J23150"
Karlboegel (Talk | contribs) |
Karlboegel (Talk | contribs) |
||
| Line 2: | Line 2: | ||
<partinfo>BBa_J23150 short</partinfo> | <partinfo>BBa_J23150 short</partinfo> | ||
| − | Group: Munich | + | Group: Munich, 2024 |
Author: Karl Boegel | Author: Karl Boegel | ||
Summary: | Summary: | ||
| + | In 2008, Jason Kelly from iGEM Berkeley 2006 team designed two promoters, **[BBa_J23150](https://parts.igem.org/Part:BBa_J23150) and [BBa_J23151](https://parts.igem.org/Part:BBa_J23151)**, by introducing point mutations in [BBa_J23107](https://parts.igem.org/Part:BBa_J23107) and [BBa_J23114](https://parts.igem.org/Part:BBa_J23114), respectively. However, these novel promoters have not been characterized yet. | ||
| + | |||
Tongji China team in 2021 demonstrated that J23104 was the most effective in the DHα strain of E. coli. | Tongji China team in 2021 demonstrated that J23104 was the most effective in the DHα strain of E. coli. | ||
| − | Our experimental approach involved the use of KLD (kinase-ligase-dephosphorylation) technique to ligate PCR products from the pSB1A3_J23106-mTurquoise-B10015 CDSmut plasmid (mTurquoise fluorophore behind J23106 promoter). This involved amplifying the plasmid without the promoter itself, but instead with overhangs that resembled the split promoters J23150 and J23151 each to facilitate overhang ligation. | + | Our experimental approach involved the use of KLD (kinase-ligase-dephosphorylation) technique to ligate PCR products from the pSB1A3_J23106-mTurquoise-B10015 CDSmut plasmid (mTurquoise fluorophore behind J23106 promoter). This involved amplifying the plasmid without the promoter itself, but instead with overhangs that resembled the split promoters J23150 and J23151 each to facilitate overhang ligation. Measurements were conduted in suitable volumes and wavelength with a plate reader in E. coli. All values account for biological triplicates and technical duplicates. Values are OD600 normalised by devision of the fluorescence mean values across all replicats respectively by the corresponding OD600 mean and in Phosphate-buffered saline (PBS) to elimate medium autofluorescence. A fast cloning protocol and plasmid maps or measurement procedure details are avliable on request. |
J23107 -> J23150 | J23107 -> J23150 | ||
| Line 14: | Line 16: | ||
J23107 -> J23150p | J23107 -> J23150p | ||
| − | J23150p = | + | J23150p = 224 % % of J23104 |
The mutation strongly enhances the promoter’s strength above the previously strongest tested promoter of the family. | The mutation strongly enhances the promoter’s strength above the previously strongest tested promoter of the family. | ||
J23150p -> J23150 | J23150p -> J23150 | ||
| − | J23150 = | + | J23150 = 201 % of J23104 |
| − | Still a major optimization in the promoter activity | + | Still a major optimization in the promoter activity incident after reversal of a point mutation causing an Amino acid change in the coding sequence resulting in mTurquoiseL9F, additionally indicating importance of this protein region for fluorescence. |
| − | 123107 -> J23150p = 50 % -> | + | 123107 -> J23150p = 50 % -> 224 % of J23104 |
| − | J2350p -> J23150 = | + | J2350p -> J23150 = 224 % -> 201 % of J23104 |
| Line 28: | Line 30: | ||
151: ttgatggctagctcagtcctaggtacaatgctagc | 151: ttgatggctagctcagtcctaggtacaatgctagc | ||
114: ttgacagctagctcagtcctaggtattgtgctagc | 114: ttgacagctagctcagtcctaggtattgtgctagc | ||
| − | J2351 = | + | J2351 = 216 % of J23104 |
drastic improvement shows that the mutation has a profound effect, bringing a weak promoter above the level of the previously strongest tested promoter. | drastic improvement shows that the mutation has a profound effect, bringing a weak promoter above the level of the previously strongest tested promoter. | ||
| − | J23114 -> J23151 = 14 % -> | + | J23114 -> J23151 = 14 % -> 216 % of J23104 |
| − | https://static.igem.wiki/teams/5102/contribution/promoter-testings.png | + | https://static.igem.wiki/teams/5102/contribution/promoter-testings-thrd.png |
| − | https://static.igem.wiki/teams/5102/contribution/ | + | https://static.igem.wiki/teams/5102/contribution/240919-1716.png |
Latest revision as of 14:00, 2 October 2024
1bp mutant from J23107
Group: Munich, 2024 Author: Karl Boegel
Summary: In 2008, Jason Kelly from iGEM Berkeley 2006 team designed two promoters, **[BBa_J23150](https://parts.igem.org/Part:BBa_J23150) and [BBa_J23151](https://parts.igem.org/Part:BBa_J23151)**, by introducing point mutations in [BBa_J23107](https://parts.igem.org/Part:BBa_J23107) and [BBa_J23114](https://parts.igem.org/Part:BBa_J23114), respectively. However, these novel promoters have not been characterized yet.
Tongji China team in 2021 demonstrated that J23104 was the most effective in the DHα strain of E. coli. Our experimental approach involved the use of KLD (kinase-ligase-dephosphorylation) technique to ligate PCR products from the pSB1A3_J23106-mTurquoise-B10015 CDSmut plasmid (mTurquoise fluorophore behind J23106 promoter). This involved amplifying the plasmid without the promoter itself, but instead with overhangs that resembled the split promoters J23150 and J23151 each to facilitate overhang ligation. Measurements were conduted in suitable volumes and wavelength with a plate reader in E. coli. All values account for biological triplicates and technical duplicates. Values are OD600 normalised by devision of the fluorescence mean values across all replicats respectively by the corresponding OD600 mean and in Phosphate-buffered saline (PBS) to elimate medium autofluorescence. A fast cloning protocol and plasmid maps or measurement procedure details are avliable on request.
J23107 -> J23150 150: tttacggctagctcagtcctaggtattatgctagc 107: tttacggctagctcagccctaggtattatgctagc
J23107 -> J23150p J23150p = 224 % % of J23104 The mutation strongly enhances the promoter’s strength above the previously strongest tested promoter of the family.
J23150p -> J23150 J23150 = 201 % of J23104 Still a major optimization in the promoter activity incident after reversal of a point mutation causing an Amino acid change in the coding sequence resulting in mTurquoiseL9F, additionally indicating importance of this protein region for fluorescence.
123107 -> J23150p = 50 % -> 224 % of J23104 J2350p -> J23150 = 224 % -> 201 % of J23104
J23114 -> J23151
151: ttgatggctagctcagtcctaggtacaatgctagc
114: ttgacagctagctcagtcctaggtattgtgctagc
J2351 = 216 % of J23104
drastic improvement shows that the mutation has a profound effect, bringing a weak promoter above the level of the previously strongest tested promoter.
J23114 -> J23151 = 14 % -> 216 % of J23104
