Difference between revisions of "Part:BBa K5267043"
Line 27: Line 27:
 
At present, some people have successfully designed a series of repetitive pseudo-palindromic NFAT reaction element guided by nano-luciferase reporter gene system[1].
 
At present, some people have successfully designed a series of repetitive pseudo-palindromic NFAT reaction element guided by nano-luciferase reporter gene system[1].
 
<br>We developed a series of Ca2-induced NanoLuc reporting systems based on Ca2+ dependent activation of dimer NFAT to monitor the effects of increased Ca2+ concentration in downstream pathways following melatonin receptor response on cells. (figure. 1)
 
<br>We developed a series of Ca2-induced NanoLuc reporting systems based on Ca2+ dependent activation of dimer NFAT to monitor the effects of increased Ca2+ concentration in downstream pathways following melatonin receptor response on cells. (figure. 1)
−
<br>The system is divided into two parts: the signal response element (encoded by [[Part: BBa_ K5267007]]) and the detection report element (encoded by [https://parts.igem.org/Part:BBa_K2728003 Part:BBa_K2728003]).
+
<br>The system is divided into two parts: the signal response element (encoded by [https://parts.igem.org/Part:BBa_K5267007 Part:BBa K5267007]) and the detection report element (encoded by [https://parts.igem.org/Part:BBa_K2728003 Part:BBa_K2728003]).
 
<br>HEK293 cells were co-transfected with a newly designed NanoLuc reporter expression plasmid to construct a NFAT response element (RE) -directed Nanoluc reporting system. With the NanoLuc reporter gene, we can detect the activation of the NFAT signaling pathway.
 
<br>HEK293 cells were co-transfected with a newly designed NanoLuc reporter expression plasmid to construct a NFAT response element (RE) -directed Nanoluc reporting system. With the NanoLuc reporter gene, we can detect the activation of the NFAT signaling pathway.
 
<html>
 
<html>
Line 42: Line 42:
  
 
===Special design===
 
===Special design===
−
In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1[2].  
+
In order to evaluate the biological implications of heightened intracellular calcium ion (Ca2+) levels, we have engineered a suite of Ca2+-responsive NanoLuc-reporting constructs predicated on the Ca2+-dependent engagement of nuclear factors of activated T cells (NFAT) dimers (Figure 1).
−
<br>These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. '''(Figure 1)'''
+
 
−
<br>To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]
+
<br>Given the subdued transcriptional impact of an isolated response element, it is a common practice to introduce multiple tandem iterations of said element into the genomic locus proximal to the reporter gene, thereby amplifying the efficacy of the signaling cascade initiation.
 +
 
 +
<br>The aforementioned reporter constructs incorporate a variable number of tandem repeats (1x, 5x, 6x, and 7x) derived from the NFAT response element (NFAT-RE) within the interleukin-4 (IL4) promoter sequence (5'-TACATTGGAAATTTTTAT-3'). This particular sequence is anticipated to facilitate the transcriptional activation of the NanoLuc reporter genes (Figure 2).
 +
 
 
<html>
 
<html>
  
 
<figure class="figure">
 
<figure class="figure">
 
<div style="width=100%;height=auto;align-items:center">
 
<div style="width=100%;height=auto;align-items:center">
−
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/8.jpg" class="figure-img img-fluid rounded"  height="200px">
+
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/7.jpg" class="figure-img img-fluid rounded"  height="100px">
  
 
</figure>
 
</figure>
  
 
</html>
 
</html>
−
<br>Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.
+
<br>'''Figure 2. Schematic representation of a new luciferase reporter.'''
  
−
===Function test===
+
<br>Consequently, this system offers a valuable tool for elucidating the dynamic changes within the signaling network following the activation of melatonin receptors.
−
In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. '''(Figure 2)'''
+
 
−
In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
+
==Function test==
 +
===Method===
 +
To substantiate the functionality of the aforementioned constructs, human embryonic kidney 293 cells (HEK293) were co-transfected with expression vectors harboring the newly engineered NanoLuc-reporter genes. The reporting system is designed to be responsive to oscillations in intracellular Ca2+ concentrations. The optimal configuration of the reporting pathway was ascertained by evaluating and comparing the relative luminescence unit (RLU) expression profiles of the NanoLuc reporter genes, thereby discerning the most efficacious design among the various constructs.
 +
 
 +
 
 +
===Results
 
<html>
 
<html>
  
 
<figure class="figure">
 
<figure class="figure">
 
<div style="width=100%;height=auto;align-items:center">
 
<div style="width=100%;height=auto;align-items:center">
−
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/3.jpg" class="figure-img img-fluid rounded"  height="400px">
+
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/9.jpg" class="figure-img img-fluid rounded"  height="100px">
  
 
</figure>
 
</figure>
  
 
</html>
 
</html>
−
<br>In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
+
☆*: .｡. o(≧▽≦)o .｡.:*☆(╯°□°）╯︵ ┻━┻( ´･･)ﾉ(._.`)ヾ(≧▽≦*)o<(￣︶￣)↗[GO!]o(*^＠^*)o(✿◡‿◡)O(∩_∩)O(*^_^*)(´▽`ʃ♡ƪ)(≧∇≦)ﾉ(*^▽^*)
−
 
+
−
 
+
−
===Sequence===
+
−
Top:  
+
−
<br>ggagtacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttt
+
−
<br>atacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttagaccctagag
+
−
<br>ggtatataatggaagctcgacttccagtact
+
  
 
===Reference===
 
===Reference===
 
[1] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
 
[1] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
−
<br>[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.
+
<br>[2] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.

Revision as of 13:21, 28 September 2024


P_1xNFAT->IgK->Nluc->bGH_polyA

Transpose and respond to calcium ion signals Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 190
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: P_1*NFAT->IgK->Nluc->bGH_polyA
Base Pairs: 1067bp
Origin: Homo sapiens
Properties: The transformation of calcium ion concentration is reported by fluorescence


Usage and Biology

At present, some people have successfully designed a series of repetitive pseudo-palindromic NFAT reaction element guided by nano-luciferase reporter gene system[1].
We developed a series of Ca2-induced NanoLuc reporting systems based on Ca2+ dependent activation of dimer NFAT to monitor the effects of increased Ca2+ concentration in downstream pathways following melatonin receptor response on cells. (figure. 1)
The system is divided into two parts: the signal response element (encoded by Part:BBa K5267007) and the detection report element (encoded by Part:BBa_K2728003).
HEK293 cells were co-transfected with a newly designed NanoLuc reporter expression plasmid to construct a NFAT response element (RE) -directed Nanoluc reporting system. With the NanoLuc reporter gene, we can detect the activation of the NFAT signaling pathway.


Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed Nanoluc reporter system.


Special design

In order to evaluate the biological implications of heightened intracellular calcium ion (Ca2+) levels, we have engineered a suite of Ca2+-responsive NanoLuc-reporting constructs predicated on the Ca2+-dependent engagement of nuclear factors of activated T cells (NFAT) dimers (Figure 1).


Given the subdued transcriptional impact of an isolated response element, it is a common practice to introduce multiple tandem iterations of said element into the genomic locus proximal to the reporter gene, thereby amplifying the efficacy of the signaling cascade initiation.


The aforementioned reporter constructs incorporate a variable number of tandem repeats (1x, 5x, 6x, and 7x) derived from the NFAT response element (NFAT-RE) within the interleukin-4 (IL4) promoter sequence (5'-TACATTGGAAATTTTTAT-3'). This particular sequence is anticipated to facilitate the transcriptional activation of the NanoLuc reporter genes (Figure 2).


Figure 2. Schematic representation of a new luciferase reporter.


Consequently, this system offers a valuable tool for elucidating the dynamic changes within the signaling network following the activation of melatonin receptors.

Function test

Method

To substantiate the functionality of the aforementioned constructs, human embryonic kidney 293 cells (HEK293) were co-transfected with expression vectors harboring the newly engineered NanoLuc-reporter genes. The reporting system is designed to be responsive to oscillations in intracellular Ca2+ concentrations. The optimal configuration of the reporting pathway was ascertained by evaluating and comparing the relative luminescence unit (RLU) expression profiles of the NanoLuc reporter genes, thereby discerning the most efficacious design among the various constructs.


===Results

☆*: .｡. o(≧▽≦)o .｡.:*☆(╯°□°）╯︵ ┻━┻( ´･･)ﾉ(._.`)ヾ(≧▽≦*)o<(￣︶￣)↗[GO!]o(*^＠^*)o(✿◡‿◡)O(∩_∩)O(*^_^*)(´▽`ʃ♡ƪ)(≧∇≦)ﾉ(*^▽^*)

Reference

[1] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
[2] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.